SelenoDB
Release 2.0
Chart Advanced
Promoter Report for SPR00000716_2.0
Identity
PromoterSelenoprotein W (SELENOW)
SpeciesDanio rerio (Zebrafish)
Promoter IDSPR00000716
Promoter release2.0
External IDNone
Transcript SPT00000651_2.0
Annotation
Prediction method(s)
Promoter prediction (5000bp upstream, N/A) [Report annotation error]
OrientationForward
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox
Sequence
>SPR00000716_2.0 # Promoter # Selenoprotein W (SELENOW) # Zebrafish 
GGGAAACTGGAGCACCCGGAGGAAACCCACAGGGAGAACATGCAAACTCCACACAGAAAC
GGCATCTGACCCAGCCAAGGCTCAAACCAGCGACGTTCTTTCTGTGAGGCGAACATGCTA
CCCACTGCGCCACCCCGTCGACTGATTCCTGTATATTTATTTCATAAAGTTTCTAAAGTT
TGTCCACAACCTCTTAAAACACACTTGGGACACGTATATATCTTAATTTCTGCAGTAAAT
ATACAGATGTAAGTGCAATACTTTTGTATATTTCATCATTTCAGCGAGGGTAATGATAGA
CTATAAATGTATGTGTAAATGACACTTGTGTACCTAATCATGACAGGGTATACATTTAAC
TACATGTACATAAGATTGTAAATACACGCAACACTATTAGAATACAGACATGTACAAATG
TATGCAAGCGTATATTAATGCATTTTAGGACATGTTGTGCATTTGTGCCATCTAGCCACG
ACTAATTTTGGCCGGGGAGAAGACTTTGCATTCGGACCAACAGTATACAGCTTTTGTGCC
GTCCTGCCATGACCCCTTTTGGCCAGGGAGAAGACGTTGCATCCGACTAATGTTTGTTGG
GTAAATGCGAGAGCTCACTCACCTCCAAGAAGGGTCCAGAAACATTCAAAGTCTAGAAAT
GGAACCAAAAACATTGTCAAAACATTTCATGTGACTTCAGTGGTTCAACCATAATCATAC
AAAGCACCAAGAACACTTTTGTGTGCCAAAAAACTACAAATGCATCTTTGTTTTCTCTTT
CATGACAGGTCTGAGTGCAGCCGTATGACCTATTGCCATTTATGCTGGTTTCACATTAAG
TGAAGTATTTGCTTGTTACTTACAAAAGCCAATGCAAATGTACAAATAGAGACAAATTTC
TACTGGGCAGCACCAATGATGTGGGATGCATGATGCGTTTGGTGCATACGTACAGAATTC
ATCATGTATTTCTCCCAATCAGCAACATCCCGCTCTCCCTCATGAAGCCAATACGGAAAT
AACTACAACTGCAATTCATCGGCTGGCCTTTGGGGGCTGGCTCCAGAAACCCCAGATATC
CACTGACTGCTATGCTAAATTGGCTATTTTTACAGCTGATAAAAACGTGTTTACAGCCTC
GTACAATAGACAGTTTTGGTCTATAGAGCTAACATTACTCTTCATGACAACTGTGAGGAG
GGTGAATTTTTTTTTATAACTCATTCGTTTAATTTATACTCTATAAAGAGCTCAGCATAT
ACATCATATTTTTGTTTTGTTTTATGTGGCTTAACCCAGTCAGTTGCCTTTTGGGATTAT
TTCCTGCAATTATGAGATAATATGGCATGCAGTGTGCACTTAATTGTGCTCACAAACCAT
TCAAGTGACCTCTTTTTCCCAGGTGAGCGAAATTCTTCTTTTTGAAAATTATTGAACAGT
CATCTGAATTGTTGTCATACAGTGTTATGCCTGGATTTCATAAATAGCCTTACATTTACT
AACACAGACTATATTTGAAGTATTTGGAAGTAATTTGCATTTCCCTCCTGTAGAAACGCA
TCAAAAGAACAATGTTTAGTGGCTTAACAGTGGTTTTAAAACAAATCGTAGGTAAACAAA
TCGCAGGTAATGAAGTATTAAGCGTTTCTCCCAAAGAAAAACTCATCTAAGCAAAATGCT
AACAGGCATTTGTAGCACCTTCTCTTTGCCTGTTTTCGGTTACTTCCAGTTGGCGCGATG
ACGCACAAAATAACGACGGTTGGCCACGCCCACTTGTAGCTTCATTTGTTCTCTTAAGAA
ACCTATTGGTGATGTCACAAATACTACGTCCATATCTTTTACAGTCTGTGCTTCCCAAGT
AAAAAGCAATTGCAGAAAAATCATGTGAGGCAAAAAAACATCCCATGAGTAAACCAGAGA
GAGTGATACAAAATGCATGTTTTCTTGCTTTTAATGTGATTCCATTATTCGAGTCAACTG
CTCGACACACAAGCATAGCATTGCCCATAGTAAACACACACCCAGGGCTTAATTTGTGCC
AAAACACGCCAGATCCGGAACCTCTGAAATATGTTCCAGCACCTCATTTTACCGATCCCC
CTCCTCAACCGCCCTGCTCCCCTGTCCGCTGTTTACTTTCACTTTCTTCCGCGACTCCCT
AACGCTTCACTTTTTGTCCGTGACACCCCTCCGCCATCCGCCGCACCAGTCCGCGCGGCA
CCTCTTCATCCTCGGGTAACATGCCGGTGCCGTAATCCCGATCTGTTCCGGGACCTCGCA
ATTCACAAATTAAGCACTGCGCACACCCTAATGTGACATGGAAGTCAAGGGGGATCAAAG
TAGTTAAAGCTTTTTTTTGGCACACAAAGGTGTTTTTGATACATCGTATGATAACAGTTG
AAACACTGAAGTCAGTTGGACTGTTTTGGCAATGATTTGGGTTTCTATGGACGTTGAACA
TCTTGGTGCTCTTGTTGTGTATTAACAGGTTACTGAACTAAAATTGTGTTTTTTGTGTTT
ATTTGGACTAAATGCTGTAGCAAAAGAGAGTTTTCATTGAATGAGTTTGAGCATAATGTG
GGACAGTTCTGAATTCAATTTTACACAAAAATGAGTTTGAAAAAAATCTAATCAAATTAA
CTGTACAAGTCACTGTAACTTACATTACACTTTCAGAAATAAAGGTACATCGTGTCACTG
GGGTGGTACCTTTTCAAAAGGTACAAATTTGTACCTAAAAGGTCCATATTAATACCTCAA
GGGCACATATTAGTACCTTAAAAGTACACAAGTGTTCCTCTTAAAATTTTTAGGCACTAA
TATATACTTTTGATGTAGCGATATGGGCCCATTAAGTACAAATGTGTACCTTTTGAAAAG
GTACCACCCCAGTGACAGCTCGCATACTTTTATTTCGAGAGTGTACATTAGACTGACTTA
AAACATCTGAAGGTTGTTTAGCCTAAAAAAAGTTTAAACATTGGCAAATTATTCTATTAT
TCTAACTTAATTATTAAGTTTAGTAAAAAAAAAAAAAACATATTGCTGTGACTTTATTCA
TACAATTTTAACAATAGGCAAGTTTTGGTCAGGGTTTTTTGAAGTCGACTCGGGCTAATA
TTTCTGACCCTGTTTTGATGTAAAATTAATGGAGCTGAAGAGTCAGGAGTCTACATTATT
GTGCATTTGTTGCCTAAATTTACAGTTGGGAAAATTAACAAGGAGCAGATGGGGTTTAGA
TGGGGTATAATGCAGAAATAAATAAAGAAGAAAGAAGGTAATTTTCAAATGAAATTTATA
TATTTTTTTAAAGACATACACGTCGAAGAGTTGGGTACAGAGTATATTTAGGTGTGAGTA
CACATTTTGTAAAATCATCAAATTATTAAAATGATTAAAGTTATTCAAATGAATAATCTA
TATTAGAGTAAAAAAACTTACCCTAAAATCTCACAGTTTTGGGACTGAATATAGTTTGTG
TGTAAGTGAGAGTAAATTTTCATTTTCAGAAAAAATAAGTACTAAAAAATTATAAATAAA
CTAATCTATCCTGCTTGAGAATTTAAGTTCTTGAGCAACGACAAGTTAAAATTAAACTCA
TTTCATTTCAGTGGGGTTCATATACTGGTAATTCTCAGATGAACTGCTCTTATTTCAGTG
GTGTATTCAAATAAAATAAAAAAAAACATTGGTTTTAAAATAGTTTTAACTAATAGTTAT
TAATGTTGTTTAAGCGTAAATTATCTACTATTAGAAGTCTATAGTGAGAATTTGCATTTG
TATTTTAAAAGTTTGTTTGTAATGGTATGTATGTATTTCATATTGTTGTATGTATATTAT
TGAATGCAAATGTTCCTGTTTATCGGCTTGTTAGCTGATTGTGATAATTGACTGCATGCT
GTTTGACTATTTCTGGAGTACTTCCATTTGCAATGCTTTACCTGATGAAGACCATGTCGG
TCGAAACATTGTGACTTTGACATTAAAGATTTTTTTGAGAGCTAAAGTGGCAGTGTGCCG
ATTTTCTTTGGATCTTTTGCTACTAATGTTTGTTTTTTGATCGTGCACCTGCCTTCAAGA
TTTTCTAGATGTGCGCACATTTCTGTTTTTTCCAAGGTTTATGCTTAAATTGACATTTCA
AAGAAAGCTTGCATTTTGTCATTAAATAAAAAGTGAATGCAGTTATAATACAGTTAAAAA
CATAATGTTCAAAACTCTGATGCATTTGACATCCTCTCATTAATGAGAGTTTGCCATCAG
ATTCCATACAAAATGATTTTATCTTTTTAAGAATACTTCAAGAATTTGGTCCAGACGAGA
TTTTGGTGGAAGATTATGAGTTTTCTGTCTATAGAGTTTCTGAGTTTCTAAAGAAATGAG
ATCCGGGAAGGGGGAATTTTTGTATTAACTGTGGAAAGCTGGGATATTATTATGAATGTA
GATATCACTGACAACCAAAATCCTTGCTCTTTGCCAAACATTGAATGCTTTATCATTAAG
TGAAGGATGAAATGCAGGGTTAACAAAATAAAGTGATTTGAAAGATAAGGTGACTGTTAT
AGAATACACTGGATCACAAATTAAGCTACAGATTTTGAAAGACAATCTTTGAAGTGGTTT
CAGAGCAATACCTAAAAAAATGACCACTAGGTGTCACTGTAGAGACGGGTTTCGAAGCAT
CGACAAATTTGTTTCGACTGTGTTTAATACGCTGCATAACCGGTGGAGCTTCGAAAAACG
TGGTTTACCTGTGCTGTAGTGTAAATTACATCGTTTGTCAAACATTTTTAGCGACAAATC
TGAGGGAACTATAGCGGAAGAAGATGAAATCTCGCGAGGAGTGGCAGGCCACTAGCTCCT
CCTCCAATCTTTCATAACAATCCCGGAAACAGCTGGAACATATCTTCCACACCCGAAAGG
AATTTGCTCATTTCGGTATCTGCGCAGCACACAGAGGCACAGCACAACCAATCCAGACAA
GACCCCCAGGCACTATCAGG
Chart Advanced