SelenoDB
Release 2.0
Chart Advanced
Promoter Report for SPR00000615_2.0
Identity
PromoterSECIS binding protein 2 (SBP2)
SpeciesCiona intestinalis (Sea Squirt)
Promoter IDSPR00000615
Promoter release2.0
External IDNone
Transcript SPT00000550_2.0
Annotation
Prediction method(s)
Promoter prediction (5000bp upstream, N/A) [Report annotation error]
OrientationForward
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox
Sequence
>SPR00000615_2.0 # Promoter # SECIS binding protein 2 (SBP2) # Sea Squirt 
GTTATGCAAGAATAATATTTTTAATATCTCTTTTCTATTCTGCAGAATATTTCAGGTCCT
TACAAGATCTTGCTTTTCTCCATATTTTTCGAATGCCTTATCCCTATTTTTAAAATATGG
TTATTCTTATATTTTATATAATATTGTATGTTGATTATTTTATTCAATTCATGTGTATAT
ATATATGTTGTTTTTATCAAAGATGTTTATCCTTATTTTCCAAATATCTTTATTTATGTT
TTTCACATATGTATATCTCTATTGCAGAAGGACCCAGTACCCCAAGTAATCTACATCACC
CCAACGAACGTGGCCCCACCAGTGTCTTTATTCCAAGTTCATTCATCCGCCCATAACCAT
ATGTTCCCTAACTCATTACCCCCTCAAGTTACCCCACCCCCCAACAGTTTGTTGGGTTAT
GGCCACCCAGGTCCCCCCATTATACTTTCACCCCCACCCAACCAAATACTGGGTAAGTCA
AATTTGAAACTCTGAATAGGATTTTTTATGGTAAAAAAAACATATTCAAATTCTTTATAG
CGTGTTTAATTATTGGTTGTCTTCAAATCAAATAAAACTATGTCATTTTCCATGTTTTTT
TTGGAATTTTTAGTAAAACCTTGATTGATATTGTTAAATGCTAAGTAAAAGGGGTGGCAT
GGTTTATATGCTAAAGTTTCTAATATGTTCCTAATATCTGCAGCTAATCGTCCTACCCCT
CCCTTTCCTATCCATCCCAGTATGATTGGGAATCGCAATCCAAACCAGGTACAACATTTG
TAAATTCTATTCTATATGAATGGGTGGGGTCCTTGAGAACCTAGGTTGTAGGCCAGGTTT
AGCCCATTACCCCAAACATACAGACTAATTTTAAAAGTATGAATTGAACATGTGACTATA
GTCCTTTGGTCTGCACTTTAAACACTATGTTTTAAAATTCTTGTGCCTAATTGTTTCATT
CCAATTAATGTGTACAAAATTGAAACATCACTTAATGTTTATGTGTATATAGTTTGGTTT
ATTCAATCCAGAGTTTAAATGCTCTGGTGGTCACAATCAACTGGTTACAATGTACATGCT
TATACTAGGAAGGATAATCTAGCCTTATGTTATAACATCCTCTTGTTGTCAAACAATGCT
TTCAAAGTAAATCCTCATGTCTGTTAGTTGTAAGAAAAGCGCAGGAACCTTTAGTATTCA
ATGTCAATCAAGTTATATATCATAACGGCTTGTTTCAAAATTTAAATTATTTCAAGCTGT
TACCTGTTTACTAATACTCAACAAACCAATACAAGTGCTGAGTGCTGACAAATATTTATC
TTAATAATGTTAACAATTGAATTGTCTTAACTCTGAACCGCTATACATTTATTTAATATT
TAAAAAAACTAAAAAACTAAAACACAGTATAGAAATTAAACTTGTTTTCTAAAATTACTC
TTTTGGCAAAATGTATGTGTGCTGTTAAGTGCGATTCTCCCTGATGAACACACCTGTATG
GGACGTTTAAATGTCAGTTGGCAAATAAATGACAAAATAGCAATTTTTAAAACAATTGTA
ATATTCCTGGCAGCAACAGTTTTATATATTGAAATCTAAATTATAAAAAAATAAAAGTTT
TTTTTTTTAACATTTGGTAAAAGTCAACCAATTAATACCAACTGTTTCATTGATGTGTCT
GTAAAGAATATAATTGAATGACACAAAACCAATGTAACCTTAAACCTACAGTACAGTAGC
ATCACCAATACAAACATGCTAGTCATGTGGTTGTTGTGTCAAATATTGATGATTATGTGT
TTGTATTAGACATATTGTGGCCGACTGTGGTTCATTTTATATTCATTTAACGTTAATATT
ATTAATGTGAAAAATAATACACTTTTGATTTCAATCTTTTAGTAAAGAAATTGCTGTTCA
TTTTAACAATATAGATTTTATTTCTAAATATAATATTTTTAAACTGAATTTTTGGTTCAA
GCAATTAAGTAACTTCATTTAGCTTTTAGTGTAAAGTTAATGTCTGCATCTGCATGCACC
CTGTGTGACTATAAAACTATTATTGTTGTAGTTATAAATGGTGTATAAAAGACCTAAATT
GAAATTATACCAATATTTAATTATGAATTACAAACATTAATTTAGAATACCACGATACCA
GTCACCACACAGCTTCCTTTTCCCTTTATTAGATCATGAAATATAAATTAATTAAAATAA
TGAAATTAACAAGTCTATTTGGCGCAATTTAATTTTTTAAATCCAAATTAAACATCCTAT
GCAAGTCACTTTAATTAGGGTAATACACAAAACAAGGTTTTAAATATCCATCAATATTAT
TGTTTTACACAAAAAAACTGCAAAACGGGATTTGATCTCAATGTACTGTTTGAAGAGTTT
TAACTAAAGAATAAAATGTAATAAATTATGAACTTGTGAACATGTATAGGGTAATGGTTA
TATAGTTGTTAACATTGCTTAAACACATTCAAGAATTCTCCCATAATTTCAGTTTTCCTT
AATGGATATCCTTTTCCCCACAGTGCCCAAGCAACAACAACTGGAACATAAACCAACTCG
CGTTACCCCCCGGCTACTGGCCCAACAATTCCACCCACCCCCCACAACATCGACATCAAA
CACGAAATCCCTCCCTTGATTTCCGACACCAAAGAAACCTAAAAAAGTTTGAGTTTTACG
GCGAGCAGCCATATGTTTCTGCCGCTGGATCCCAGTTTTTGCAGGGACACTTCGATAAAC
GAAAGCACGACAAACGGAAAACAGTGGATGAGGTTCCAAGCCGAGAACGAAGTCCAGTTG
TAATGCAAACTCACGAGCAACCTAATACGAACAACCTGCACTTCCATGGGGACAACTCCA
TGATCATGCTATCGGTAGGGATTCAGTTTTTGTGCCATTGAGTTAGCTAAATATTAGAAA
GTTGATTGAAACTAGATTTAAGTTTTTAGGTACATCAAGCACAGATTTTTTGTTTAGTTT
CAATAGAAGCTTTACACCACATGTATGACTATTGTTTCGTTTATACACTTCGGTTTAAAA
ATAAAACCGGAAAAAGTTAAAAAATACTATTTTATTTTAGTAACACATGTATTGTTTAAT
TTGCTTTAACAGGACACGCAAGAGTTCCCTGGGTTAGATGGAAACTTCTTCAGCACGTCA
TCTTCTCCTTCAATCAATGCATTCTCATATAGTGCTGCTGTTATGGGGAAGATACCAAGG
CCCATCGCTCCGGTATGTCATGTATTATATCATGGTTAAAATGCATTAAGATATAGCAGT
GTTACAGCAGTTAAACACATATGTTGCAATCATTTGGAAAATGTAAATTAACAGATAAAC
AGCAGCGCCCCTTACCCATCCTCTGCTGCAAACCTCAATGAAAAGTCCCAAGCACAGAAG
ACTAAGAAGAGGAGGAAGAAAGCAGAGCGGGCTGCGAGAGCCGCAGATGAGGAATATGCA
GAGATCAGCAAAGAGCAAGAAAATATACAAGTATTTAAAATTAATTCAAAAATTTGTTTA
CACTTTGTAAATTTTATTTTGTAAGGGACCAAAAATTTAAGCCAGATTTGACCTGTTAAC
CGATAGGTGTTTTTTAAAGTTTTTTTTTATTTGCGTAGATATACGAGTATGTGTAAAATT
AAAGTTTAAAATATTTTTAGACTTCTATTCTATACGGGCGAGGCCGTTTGGACCTATATA
TTAATCCAGATTTGGATCTTTATTACCCCAAAAGTGCTTTTCTAAATTAGCTGTTCTGGT
ATTATTTGTGTACGATAATTTGACGTCCTATACAATGAATATATATAAAATAACATTACA
CTACAATACCTTTTAGACGATACTAACCTATCTATAAACCACAGAAAGTGCTGAAGAAAA
CAGCTTCGTCTCGAAACAAAAATAAAAACCAAGTTCTTGATTTGGGTGAATTCTTGACCT
CAAAGTTTGAGGAGAAAAAACTATTGTCGGACTCTCCAACTAAAAACACTGAAGTTGCGA
AATCTTGGGAAGAAGGACATTTAGTTGCAAAACCTCCACTTGATTTAAATATGAAGTGGG
TTCTCTTGTTGGTATTTCTAGATATTACACTTGTTTTCTTTTAGGCATTACAATTATTTT
TTTAAACAGCTCTTCTGGCATTTATTTGTGTTCCTGTATTTAGAAATACTGTAGGAATGA
CACCCAGTTGAATGCTAGATCCTAGCTGTTTTAGATAACCAGTTAATATCCAAAATTATC
ATAATTAATATATATATTTAATATCTTTAAAATATAACAGCAGCCGTTTAAACATGGAGA
TAGTTTTTAATTATACTTTGACATTTGATTGCATATTTTTGTAACTATTTCATGGATAGA
GCATTTTACAACTTTTCAGGATTTGTTACATTTGAGACACTCCATACACGTTGCCTTTGC
TATATTAACTAAAGCAAAACATTTTTAATTGTTATTTTTTATTTTCTGGATTTACAAAAC
AAATGATTTCAGAAGAAACAGTAATACCCTTTTTGCATGGTCACTTTTATGCGCGTAAGT
ACTCGCATATTTACTCGCAAAAACAAAGTTAACACGCATAATGTCATAAGCATGTTACCT
GCTGTAGGAGGTTGGTTGTTACTCGCATTATGCGAGTAAAGAAAAGTATGGTGGAAGTAC
AGTTTCACTTTTAAGAGCCTAATCTTTTTCGGGTATTATTTTACAGGATTTAGTTGGTAA
TAGCACCATGAGGTGTTAAAACTTATTTTATAAACTAGATTTACCAATATTGCGCTAAAA
TAAGCTTACTGAATGTTGATACGCGCATAAACAAAATGACCATGCAAAATAACGCTGTTA
GCGAGTTATCATATGACGAGTTGATGCGGATCGCTATTCGCATTAACTTTTTACCATGCA
AAAAGGGTATTATTGAACTTTAAGTATACTGTTTATTATTTAAATTATTATTTTGTATCA
GGATCAAACCAACTGGTCCT
Chart Advanced