SelenoDB
Release 2.0
Chart Advanced
Promoter Report for SPR00000227_2.0
Identity
PromoterIodothyronine deiodinase 1 (DIO1)
SpeciesAnolis carolinensis (Anole lizard)
Promoter IDSPR00000227
Promoter release2.0
External IDNone
Transcript SPT00000186_2.0
Annotation
Prediction method(s)
Promoter prediction (5000bp upstream, N/A) [Report annotation error]
OrientationForward
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox
Sequence
>SPR00000227_2.0 # Promoter # Iodothyronine deiodinase 1 (DIO1) # Anole lizard 
GTGATTTTTTCAAGGTCACCCAATGGATTTCCATGTTTGAATGGGGATTTGAACTCTATT
CTCCAGCACTGTAGTCCAGTGCTCAAGCCACGATGCAACACTGGCTCTGGCAAGAGATGA
TAGGGAACATTTTCAGTTGAAACAGTAGTCTTTCTTTCAAGTATTACCTTAGATTGAAAC
CAGCATAATGAAACTTAACATTCGCTAATTACATCACAATGTATGCTTCTCCTTGTTTAT
TGTTACATGTTAGTGAAGGTACAGACTAATGCAAGGAGTCTCAACCTTTTACATCTGCAG
GGCCCATTTTGAAGCAAAGGTTTTTTGTGGAGCCTCAAGACATGTTTATATATTATATTA
TATGTAATGTATATCAGGCATAGGCCGGGCCAGGGGCAATGGATGGAGAATGTTTGTGTG
AACTAATTCACACACTAAGTATATACAAACGGAAATACAGTGTTTAAAAAGAAGAAAAAT
TGTAAACAACATACACTACAGCATTTCAGTGGAAGACCCCAAAGGGCATCCAGTCCACCC
CCTTCTTCCATGCAGGAAAAACACAATAAAAGCACCGCCAACAGATGGCCATCAAGCCTT
TTGTATTATTATAATTGTGCAGTTTTCTGACATTGTATATTTCTGCCGCTTCTGTGACTG
TTCATTTGTATTTTGATTCTGTAGCCCACTAGTCGATGGATGCCCAGAATCAGCAGCATC
CACCGCGATCATTTTTATCCTGGGCAACGACCGAGCCAGTATAGACTTTGTTTTGGTTTG
TTTCTCCATAGTGCTAATGGGTTAGGTGCTCTTAGTTCCACTCCTCAACTGAGGCCTCTC
TGGCTTAGTTGGACCTGCCGGTAGTTACACTACCGCCAGCACAGCTCTCAGCGTCCTTGG
AGCAGTTAAGGCAGGGGGGCCTTAACTGCTCCAAGGAGCCCCCCACCACAACAAGGTGGC
ATCCATTGAGGGGAACACAACACACCAGACATCACGGTTGTGGAAAAGAAAAAAGTTTGG
ATTATTGATGTCACCATACGAAGTGACAGTCAAATTGATGAAAAACAACAGGAAAAACTC
AGCTGTTGACAAAATTACGATCTGTCACCTGCAAAAGGCCACCTTACTGGGATCTGCATG
CATCATTCTAAAATACATCACACAGTCCTAAACACTTGGGAAGTGTTGTGATTTTGTGAT
ATGAAATAAGACTTGTGATTTTGTGATATGAAATCAAGCATATATATATATATCTCATTT
GCTGTGTCATACTATGTCTTTGTGTCAATAATAATAATAATAATAATAATAGAAACCCTA
GAGGCCATCCAATCCAACCTCCTGTCATGCAGAAAAACATAAAGCTTGAGCAGTGGGAGG
GAAATAGAATTTTGGAAGCAAAGGAAGAGCAGAAGGGGTCTGGGCAGTGAGAAAAAGTGT
CTGGGCAGTAAGGGAGGCGGGAGAGAATGGGTCTGTGCCCTGGGAGGACTCTGCTGCATC
TGCTGCTGCTTGAAACAGCTCAAAACTTTAATTTTCCTGCATTTCTCAGGAGAAGGAAAG
AGGAGGAGACGGGAAGCAGCCATGGAGCCCCTCACTATCACCCGCAAAGCCCCAAGAGCT
CCACAGAGCACAGTTTGAGAACTCCTAGTCTGATGTAATGCACTGCAGAACATTTTAAAA
ATTGCACAGATTTTAACATATCAAGAATGAATATATTTATCCTTCATATTAAGAACTCCA
CAAACCTTCAGATATGGAGATCATATGAAGTATAATCACGACAAATCACTGAATAGTACA
ATGGATTTGGATGACTGTTGAGTTTTGGTTTCAAAGCCTAACAAAGTTGTAAACAAGTAG
TTCTCATTCTAGTGCTGCATGGTTCCTATGAGGCTAAAAAAAGAAAGACATTTTGTCTCA
TTTACTACTGAAGATAAAGATAACTTAAAAAAATAAGTACCAGTACTTGGTGACCAATAA
AAATCCTACATAAATCAAGTGAGATCTCCTTACATGAATGGTGTTTCAGTCCATGTATGA
AGCAATATGAGTGGGCAAATCTAGAACAGCTTGATTTCTTCGGATTCTGGTTCCAGACAA
AAGAGTATATAGACCATAATTCCTGACATATTGAAAATGGCACATGTGATCTGATGAACA
TTTCACTTAACAGATAATTAAACAGACAAATGTTTACTCTGATGTAATCTCAAAGCCTTA
AAAGCCAATAGAAGTAATCACTGCATGTTGAAGATAAACAGGTCTATCAATGATTAACCA
CCCCATCTTGTTCTTCCCTCTTCCTTTTACTTCAGTTGTAGTTTGGCATTCTGCTTTGCA
CAACTTTGCCGCTTCTCATTCCAGCAGTATGTTCAAAGCTGGAAGATTGGTGCTAAAGAC
TTGGCTTCTCTTGCAAGTATGCCTGTCTACTGCTGTGGGTAAACTTTTTATGATCTTGTT
TCCAGCGACTGCTAAGAGATATATATTGAAACAGAGCGAGAGGAGTAGCATGGGGAGGAA
CCCTAATTTTGTCTATGAAAACTGGGGTCCAACTTTCTTCAGCTTCCAGTACTTACTCTT
TGTCTTAAAAGTAAAGTGGAAAAGGCTGGAAGACAAGGCACTTCAAGGCTGTCCTGCACC
CAACACCCCTGTGGTAGATTTTGATGGGAAAATTCATCACATCCTGGACTTCATGCAAGG
TAAATTTTAAAATGATGGGGATTTTTGAAACTTCGCTGCATCATTAGAACATAATCTGAA
CGGGTTTCAAAATCCCCTTCAGAACATGCTGAGCTTGAATTTCAGCCATGATTTCACAAC
CCATGATCTCTCAATTTAGAGCCAAAATGTATCAAAACCAGTGTGAACTGTTAGAAACCA
TCTTAAACAATTATATCTATCTTGTGTGGAGGGCATCATACCCCCATTTTCACCTGTATA
TGATGAACTGGAAAAATAATTTTCATAAATAACAGTGTATTGATTTTGGTCCTTTAAATG
TTTATTCTTATAATTTGCTGTCAGATCTCTGGAGAAAGCAATGGAAAATATTTATATCTG
ACAATACCACAATCCTAAACACATTCAAGTATGAATATAACATATTCCCAGGTAAATCTT
AAAAAGATAACAGCTTGAACCTCAGATGTATTTTAATCGAACATAAAAGTAAATGGAAAA
ACTCCTCTAAAGCGAAATGTTTGTTAAAGTTCTAGTGTATAAAATTGTGTTGGAGAAGTA
AAAACAAATTGTACTTTGCCCTCTCTTCCACCATTCATGAATCATTAAACTATTCTTTTC
AGTAGGTAAAATGTAAGAATATTCAGATGGTATCACTGAAACTGGAAACAGTACACCAAG
AAACCAAGTATGATATGGCTTCAGAAATCAAAGGGAATGCTCTAGATCGGGGCTTCTTAA
ACTTTTTTTCCACTGATGGCCCCTTTCTGCCTGAAAAATGTTTACCTGACCCCAGGTTTA
TAGGTAAAGTATATAACATAGGTAAAAAAAATCAAACACTTACTCATAATAAATCAGCAT
TTGCAGGGCTTGCTAAATAGGTTGGTTTTCCTTTTTATGAAATACAGCTGAAGCATATTC
TGCAGAGTCCAGTGTAAACACCATATGTTGTTGCCAAAAGATTTGTGTAAATGTCTAGGT
GGCATTCAGAAATCTTTTACTGTTGCCAAATTTTTCATGATCTGATTTGTGGTTGGAACC
CACAGTTTATGATGCCCTATTCTAGATGTAGTGAATCTTAATTACAAAAGTTAAAACATA
TTCAACAAAAAGTTTTATGACATAGAAAAATTAAAAACAAAAGCATAATAGTTAAGAATG
TTAAAAAAAAAACTAGAATGCATGAAAGCGGTCAGCCTTCAAAGGTATCTGAATACAAAA
ACTTCCCCCTGAGTACATAAGGATAGCAAGGAGACCACCAGTGTACCTTCTCTAGAAAGG
TAGTTGCGAAGCTTGAGAATAGCCCCCCAAAAGGCCCCCTCCTCTGGTTTCACTAAGGTG
AGTATGGCAAGACATACAGGAAAGCCCTCCTCAGAAGACCTCAAGATGTGGACAGCTCAT
GTAAAGCGATCCTTCTTGAGAAATGCAGGGGTTCACAGTAGTACCTTTAGGTAGATTTGT
AACTGGTTAATGGATCAGACCCAAAAAATGCTCACCATCATGTACAGATGTGATTAGTGG
GATGACATAGAGTTCCTTCCTGGACTTGCTGGTATTCAACCTTGCTGGTATTCAAACAAA
ATAAATGTTTTGACAATGGGATAAAGGGGAAGATTATCAAATACCAAATTAGGAGGAATT
GTTAATATCTCAGAGAACAGAATTCAGATTCAAAATGACCTTAACAGATTTGAGGCCAAC
AATTCACACAATGATTTTTAGGAGACTATAGTTTAAATTCCCGCTTGTCTATGGAAATCC
ACTGGGCGACCTTAAGGAAGTTATATGTGAGTCTCATCCGCAAAGGCGTTTTCTCTTTTT
GGCCCTGTGGGGGCCACGGACAAAGGGCATTACAACACAGGCAATACAATTTCAGACAAT
TTCAGTTATTAACGTCACTTTTCATAAGACAGCCCTAATAAAATTGCTGAGAAGTTTTTG
TGACTGATCTTAGCCCTAGAAACTATCTATCTGGAATCACATATGCTCTTTCTAACACAC
AATTCAAAAGCAATAGTGCAGCTATTTACTGGTTTCCTACTTTTATAAACTGTCTACAGG
AAGAACAAACATGGAAGCGGACAGAGAAAACATAGGAGAGTTACAAATAGAAGACTAATT
TTCTAGACATACCCAAAAACTTATTTAAATGAATTTATGTGGAAATACAACAAAAGCCTT
TCCTGGAAGCACTCACTGACCTCTGGAATGTCTACATTTTATGCTGTTTATACAATCAAA
TCTTAAGTTCCTATATATAGAGGCTTACATGTTACTTTTTGTATCCTCTCACTTCAAAGA
CTGCTTCATCTTTTGCAGAT
Chart Advanced