SelenoDB
Release 2.0
Chart Advanced
Promoter Report for SPR00000011_2.0
Identity
PromoterIodothyronine deiodinase 2 (DIO2)
SpeciesHomo sapiens (Human)
Promoter IDSPR00000011
Promoter release2.0
External IDNone
Transcript SPT00000009_2.0
Annotation
Prediction method(s)
Promoter prediction (5000bp upstream, N/A) [Report annotation error]
OrientationReverse
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox Forward Reverse  
SNP (Present-day Humans) SNP (Neandertals)
Sequence
>SPR00000011_2.0 # Promoter # Iodothyronine deiodinase 2 (DIO2) # Human 
TCACCTCTTCACGTTTTTCTGCCTGCTTTATATTTGCTGGCAGCTGATTAGATTGTGCTC
ACCAGATTAAGGGTGGGTCTCCCTTCCCCAGCCCACTGACTGGAATGTTAATCTCCTTTG
GTAACACCCTCACAGACACACCCAGGAACAATACTTTGCATCTGTCAATCCAGTCAAGTT
GACACTCAGTATTAACCATCACATACTACAATATTTGACCACCTCACTCTCAAGAAATGT
TCCTTCTAATTAATAAATCATCCATGTCCTTTTGCCCTGCCTCCTTCAGAAGTAGATATT
AGCTTTGTTTTTGCCCTTTCCAATAGGCCTCCATATTCTAAGTGATTTCATATCACTGTT
ACATTCCATAGGCTGAATTACGCTCCTTCATTTAGCCTCTTTCTTACAAGACCAATTTCT
GGCATTAAAATCATGTTTCTAGTATTCCTCTAATATCCCACTATAGTTGTGAAACTGAGG
AATGGTCCCAAGATTTGAATTAACTGATTTTTTTCAAGACATGAGTATAACAGAGAGACT
AAGATATATGTTGAATGAGGTGGATGTGTTGTGTGATTTAAGATTAATATTGGATCTTTA
ACTTAAAGAACAATTAGGTTAATTTCATCAAAATCCTTCTATTATGAGTGGTTATATATT
CCAGATGCATTCCTAGCAAGCCCATGAAGTTGCTTTTAGTCATCCAAACTCTCAAGAAAT
TATTAAATAATATCATCTGTGACTTCTATATTTAGAATTTAATCTATAAGGTTATGTAAC
AAATTGAAACAAATGTTTCCTAAGTGAGAGTAAACAAGACTTTTGCGTAAGAACAAATGC
AGGGGACACCATGATCTCTAGCCTATTTACAAAAGTTATAAAAATTACAGATACTTTCAC
ATGCCTGGCAGATTTTATACCAACTGACTGACTACTGTAAAACAGCAACTGCATTACTCC
ATCCTACGACAGCCAATAGAGGTGAGGCTGTCCATCCCAACCCATTTCTCCTTCTTAAGT
AACAATAAAAGATAAGAGTCCAAAATCAGAACCTGTTTTACTCAAGCCAGTTGATGTAGT
CATAACTAACAATGACACAAGAGACCTGGGAGCTCACGTTAGAAAGGATGCATTTTCAAT
TGCCTGTAAAACTTTTTCAACATATCATCGTCAAAAAGATTTCATTCTTTCTACTTTATG
TACACTATTTTTGGCCAGGTTTCTCTAACTAAGCACTATTGACATATTGGGTTGGATAAT
TCGAGGCTGTCTTGTACATTGTAGAATGTCTAGTAGCATCCCTGGTCTGTCTTCACTAGA
GGCCAGTAGCACCACCCCATCCCCGACCCAGTTACGACAATCAAAAATGTCTTCAATATT
GTCAGATGTCCCCTGGCAAACAAAATTATCCCTGTCATTTAGAACGCATATTAATACTAA
TCAGTACAATAAATTGGCTGAAATGGGATAAGTTAAGAAAAAAAAAAGCAGAGGACTAAA
CTCTCTTTTACATTGGTCTTGCTTTAAAGAAAATAATAAAGTTGTAAAGCAGGCCAACAA
GGACACCCCTTCACATGAAAGACAGGCTTTTTTAAAAGAATAATTGGGAGTTTATTTTCA
ATCAGCCAATTTTGTGGCCAAAGGATAGCCTGTTCATCTTTTACATCCCTTCAACCCTTC
TCACTGTGGGTTTCTGGTGATGAGAATTTTAAAGCCAATCTGTGATTTACATAGATTACC
ATGATGCCCAGGACAGGGAGGCATTCACAGAAGTTCTATTCATATATGTATCTAGAGCAC
ACAGAGGCAATGTTTCTGTATTAGACACAAGCAATTTCATTAATTTAAGTGGCCAACAGG
CAGAGTTTTAATTCCCTGGATGATCTAGGAGTGGAGGTAAGGAGAAAAGGACTTAAAAGA
GGCCAACTGAGATGCCTTTCCCCTGTTTTCACCCCAAAAGAGAAATCTCTGTTCTTTCTA
CAGCGATGAAACTCAGTGATATTGGTCATGGGGCTCCCCATTGCAATAAGATATCATAAC
CTTTAAGAGAAATGGAAAGTTAGGAAGCAGATTTCCAGGCCTTTGTTTTCAAAATAATTT
TTAAAACTATATAAGCACCCAAATTTTAAAAAAATTATTCATCAGTAGCATAAATTTCTG
TGAATCTTTGTAGAAATGACAACCATTCTAGTTGCTGGGACTCTATGAAGTGTCCACTTG
CACTGTGATTTTTCTTCAAATGATGTAAATGCTTGATATTTTTAATAATATCAGGGGTTA
CATGATACTCTCTAGATGTCTATTCCATTTATTTTATGGTCAAAAAATTACAACCCTGCT
TTCAGATCTAAATAATTCTCATAACTCCCAGAAACACATTACAGTCTTTCCACCTGTTAC
CAAGTGAGAGCAAAGCTTAACAACTGGCTTTCATTTCTGGTACATTCAGCCAGCAATTCA
TTTCTGCCCATCCCACAAAGAAAATGCATGTGCAAAAAAAAATATGGGCATGTGTTCATG
ATTATTCTTTTCAATCAGACATCATCATACCGGCAATATTGGAACCTTCCTGTTCCTGGC
ATCACAACCACTCCCTTCCAAAGCAAAGGACATGAACCCTGCCTGAACTCCTGTACCAGC
AAGTCAAGGGCTTCTACTGAGGATCTTTTTCAGAGTCATGCAAAATTGAGTTCAAGAAGT
GTAGACTGAAAGTAGACAGGGCCTGTTCTTTTTGCCAGAGATAGGCACTCCTGCCCCTCC
TTCTGATTAAGGGTTTTGTTCTTTTGATGGAGGGAGTTTCAGTGGATGAGGAAAGCTACC
CTTGAATTATCATCTCTTAAGTGGAAGCTGACAGTGCTAATAGTTCAAGCACAGGTTGAT
TGATGAGACTGTCCCAGACTTAGAGGCAGGCAATCTTTGTCATTGCAAGGCTCAGGCAAG
CAGTTTCACCTGCCGCAATGCTAGTATCACTCCTCCTCTTCCCATCCTGCTCAAAAGTAA
GTGAGGAGCACTACTCTTACTGAGCACAAAAATCTCAGGCACTCTGAGTTTTGTTGACTT
CACAGATCTGAGGACTTTGGTTGACAAATTGGGATTCCTCTACCAATGATTCTTAGTGAA
TAAGGTAGGATATGGAAGAACATGGGGGAAAAATCCAGGTTTTTTGAGGCCTGAAGCTTC
TATAATTTGGGGGCCCTCTTTAAGAAAAAAGGTATTACACATTTATAAATACAAAAATTA
GGTAAAAAGTCTATAGTTATTCAGAACGTGAAAAAAGCTTGCAACAAATTACAAATTTTA
AAATCCTGAGAAGTACCACAAACATCACAAAGCCCAGAAAAAAATTGCACAATATTTTAA
AATTCATTACCTATACATTTCTTACATTCTGTGACTGTATTTTCTCCAATCACCTCTTCA
TAATACAATAATATTGTCATGTAATCTTCTATAGAAAGAGCAAAAAGATAATAGTCTTTT
CTGTAAATCTGCAAATAGGAATAATGTTCCTTCTTATTGGCTGTTTAGAAGATTTTATTT
CAACTTTACAACCCATTAAAGGCAATGTAAAATTTTATTATGGGTGGTACATTTTCTTTC
ATATGAGAGCTGTAAGTCTGGATTTTCAAGTAATGAGCTTCTGCTTTAATACATTTTTAA
CCTTATTTTTCCTCCACAACCACATTTCTTAGTCCTCTTGTTCTGTACCATGCTGTCACA
ATACCAGGCGATTTCTCACAGAAGACGGTATGCCTAGAAGTATCCCCATGCTCGGACAGA
TAGCAACATATTCGCTATGACTGCAAATCACACATATACCATTAAATCTAAACTAAATGT
ATTTCTACTAAAATTGCTGCTCTTCAACTCCACCGAACACAAAAAGTATGAAGGTGCAAA
AGTCAGGATGTAAAAAGACAGTTGTTTCAATCAGTTGTGGTTAAAATGCCTCACTTTTCT
AAATTTTGCAAAAATATATGACTATGTAAATACATTAAAAGTGAAGGGCTTGAAGATTAG
CTTCATTAGCATCAGCATAAATCCGCCATAGGGAAAACAGAAAAGGCTGTGCACCCTGTT
CAACACTCTCATCTCTCTCTGATTTTCCCCAAACTTCCCAACTTGTTTTACCACAAAGTC
ACTGGCAAGAAAGTTACTTATGTAGACTCTGCCAGGAAAATTTTTAACACTAGAATGACT
ATATTAATTGTCAAAGGAAGACACCATGAGGATTTAGGCCCACACTCAACAAATACACAG
GATCTTGGGAAAATCAATGACACAGATACAGAGCATTTGGAGAAATAAATACACAAAGAC
AGCTTAATTCTGTACATATTCATGTCAATGCACGTATTATGTATTTGTTAGACCAAGCAT
TGTGTATTAGTCCCTTTTCATGCTGCGGATAAAGACATACCCAAGACTGGGTAATTTATA
AAGAAAAAGAGGTTTCATGGACTCACAGTTCCACTTGGCTGGGGAGGCCTCATAATCATG
GTGGAAGGCAAAAGGCACAACTTACATGCAGGGACGCAAGAGAGAATGAGAGCCAAGTGA
AACAGTAAACCCATTTGATAGGTTTGGCTGTGTCCCCACCCAAATCTCATCTTGAATTCC
CATGTGTTGTGGAAGGGAACTGGTCGGTGGTAATTGCATCATGGGACAAGTCTTTCCCAT
GCTGTTCTCATGATAATGAATAAATCTCACGACATCTGATGATTTAAAAAGAGGAATTCC
CCTGCACAAGTTCTCTCTTTTTGCCTACTGCCATCCATGTAAGATGTGACTTGCTCCTCC
TCGACTTTCACCATAATCGTGAGACCTCTCCAGGCATGTGGAACCGTAAGTCCAATAAAC
CTCTTTCTTTTGTGAATTGCCTAGTCTCAGGTATGTCTTTATCAGGAGTGTGAAAACAGA
CTAATACACTCTTATAAAACCATCAGATCTCATGAGACTTATTCACTACCATGAGAACAG
TATGGGGGAAACTGCCCCCA
Chart Advanced