SelenoDB
Release 2.0
Chart Advanced
Sequence Report for SEQ00002779_2.0
Identity
SequenceSelenoprotein M (SELENOM)
SpeciesXenopus tropicalis (Xenopus)
DescriptionGenome -assembly-
Sequence IDSEQ00002779
Sequence release2.0
External IDNone
Gene SPG00002784_2.0
Annotation
Prediction method(s) None
OrientationForward
Toolbox
Sequence
>SEQ00002779_2.0 # Sequence # Selenoprotein M (SELENOM) # Xenopus 
ATGCACACTATCAGCTTACAGGAGGCTTTATTTGGTAGTAAATCTTGTTTTATTGTGTTG
GGTTGAAAACCCCAACATACTGTCCTTCGACTTTGGCTTATTCTTCTGCTTCTTCTTCTT
CTTCTTAGCGCCCCCCATTTTCTAAACGCTACTCCTCCTACAGTTTTAGGGGTACAACAC
CCAAACTCTACACACTTCTTCGCCCTATAGTGGAGCAGGTTGCTTGTGCTTTTCTAAGCG
ATCCCGCCCCCCGTCTTTTTGTGGCGCCGCTCCGAACCCCCCAATTTTCCCATTGACTTT
GACAGGGAAGATTTTCAAACTGCTGCCACGCTTACAGCTTTAAAGCTACACTCAACAAAC
TTGAATAACATAATCATGGGGTCACCCCGAATGAAACAGCCACTTTGTTGGATGACCCCA
AAGTGGGAGGGGCCAACAACAGCCAATAAAATTTTATCCATTGACTTTAATGGGGAAATT
GAAACTGCTTTGAGGCTACAGTCCCCAAACTTGAATCACATAGTCATGGGGTCAGTCTGA
ATGAAAATATGATGATTGTTGGATGCCCAAAAGTGGGCGGAGCTGTGAACAGCCAATCAG
GTTTTACCTATTGACTTGGTGGAAATTCAGCCTGCTGCCATTCTCACAGTAACAACACCA
GGGTCCCCAAACTTTGCAGAGTTAGGCACCAGGTAACTGCGGTTCAAGGTTAGAAAAAGT
GGGCGGAGCTACCAACAGCCAATCAAATTTTACCTATTGACTTTCAATGGGGAAATTCAA
CCTGCTGCCATTCTCACAGTTTCAACCCCAGGGTCCCCATACTTTTCACAGTTGGTCACT
AGGGGACTGCAGTTTTAGTTTTGAAAAAGTGGACGGAGTCACCAACAGCCAATCAGATTT
CACCTATTGAATTTTATTTATTTTGATGCCAGGGTTCACAAACTTTGCACAGTCAGTCAC
TGGGTGACTAAGTTACAAGTTTAAAAAAGTGGGTGGGGCCAACAACAACCAGATTTCACC
TATAGAATTCATATGTTTAAATTTAAACTGCTGCCATTCATTAAATATTAATACTAAGGT
CCCCAAACTTTGCAGAGCTAGTCACCAGGTAACTGCGGTTCGGAGTTAGAAGTGGGTGGA
GCCACCAACAGCCAATCAGATTTTAAATATTGATTTTCAATGGGGAAATTCAACCTGCTG
CCATTCTTACAGTATTAGCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNAGTTATATAGTAAAAACCACTGTGCAAATTTTGGGGACCCTGTTTTTTT
TTTTTTTTTTGGGGACCCTGTTTTCAGATCAGATTTCAACCCAGCATGAAGTTTGTTCTC
AAACTTCCCTTTCTAGTTCAACCTAATCTTGCCACCAAGTCTGGAATTCAAAAATAATTA
CCTGGTTTGGGGGCACTGGGAGCAACATCCAAGGGGTCGGTGAGCATTATGTTGCTCACG
AGTAACTGGTTGGGGATCACTGCTTTAAAGCATACCAGGCCCTACCATCAAGAGTCTTTC
AAAAGCTTTTTCCATTCTTATTTGCCTTATGCAAATATTAACATACATATTTATATTCCT
CTCCTTTCTAACTCTTCTAAAGGTGCGTCCTAGCCTTGGCTGTGCAATAGTTCATATTCC
TCATCTCCTCTAACCCCCTTTAGCCAGCTTCCACATGTAAAAACCAAAAGGGCTTAAGGC
AATGGGCTACTGTTGGGGGGAGCATGGTTTTAGATCATTTGGCTGGATGTTATTAAACCA
TATTGGTACCTTAAAATAAACCATTTGAAATAAGGTTGATGTGAAGCACCAAAAACCATC
ACTGCCATCTCTTACTGCTATAGTTGTAATGGTTACAATTATAGCAGTAACATAATCCTC
AGAGGATATCATAGACAACCTTATACTAGCAGTATGGTACTGCTAATACAAGTTTGTCTA
AAATATTCTCTGAGGATTTTGTTAAAATGTTGAGCTCTTTTTAATTGATTAGTTTGCTAA
CCTGAGCTTGGAGATAAGATGGATGGCCTGAATAACAGGTTATCCATCTTATCACTGCTT
AGAAGATTACCCCCCTTGGGGACACACTGCTCACAGTTCAAGCAGCCTTTTTATCATTTC
TGGATTGTAACATCCTTTTTAGCCTTAAAGGGCACCTAACACGCTAAAATTGCTTCAACC
ACCAGAGGTGCAAATGCAAGCATATGTGCAGGAAGCAATGGACACAGTTTCAAGCATGTA
TTTTGGTGTATTATCAGTAAATTTGTTCAGGCATGGCTATCCCAGATACTGGGATCTGAA
TGTGGTTGTGCAATAAATCTGTTGGCCTATCTTTCAAAAGCTTTATAGATGTTTTTATAT
AGCAACACTTTAAATGTCCAGGGTACCTTGACAACACTGAGGGGCCCGTTTCCATTTATC
AAAACATTCTTGTTTGTCAAAGCTGATAGAGTATCCAAATGTGCTTGACTGCTTTTAGCA
GTTTATATGGGGTATTAGTGCTCAAGCATGAGCAGGTCAGCAGCAGCAGGCACGAGCACT
AATACCCATTAAAATAATAAATCTCCTGTACAAATTGCATGTGCAGATTAATAACGCCAT
ACTAGAACAAACTGATCCAGTGCAGAAAATAATAAACTGTTACATTGAAAAGGATTGGTA
TTATTTTACATGCATCGGTACTGCTTGCAGAAAAGAATAAGGCTGATGGTAAATTAGGCT
CTTCATGTATTTAAACAGTAACCCATTAACAATGGATTTTTCCTGAGTGCCCTGGGCACT
GCTAAGTAATTTAAGCAAGGTGGCTTGAGTAGCTACTACCTAACTGGTTCAGCCAAATGA
AATTGTGTCTGCACTGCCAAAGGAAAGTATAATTGCTCACAGGAGAATATTAAAGGAACA
GTAACACCAAAAAATGAAAGTGTTTTAAAGTAATTAAAATATAATGTACAGTTGCCCTGC
GCTGGTAAAACTGGTAAGTTTGCAACAGAAATGCTACTATAGTTTATATAAATGAGCTGC
TATGTCAACATGGGGGCAGCCATTGAAGCTGGGAAAAAGGAGAAAAGGCACAGGCACATA
GCAGATAACAGATAAGCTTTGTAGAATATAATGAGGTTTTATCTGTTATCTGCTAAGTAA
CCTGTGCCTTTTCTCCTGTAAATGGCTGCCCCCGTGGCTACACAGAAGCTTTATTATATA
AACTATAGTAGTCTTTCTAAGGAAAACACAGCCGTTCTACCAGTACAGGGCAGCATTACA
TTATATAGTAATTACTTTTATATACTTTCATTTTTTGGTGTTACTGTCCCTTTAAGCAAG
ACCTAGCGTTATAAGAGGTACATCAACTGAATGACAAGCACTTACCACTTAGCACAGGTT
GTTAATAACACATTTGCCTTATGTATTTTCTGTTCTTTGTGGCATGGCAACTTTAAAATG
TATTAATAAACAATTTCCAATACATAAAAAATAATGTAAAAAATGGAAATTTGAGATGCT
AGCACTCATTTGACCTGTTCCATTTCAGGGTCTTTGGGACTTGAAGCAGAAATGTATACT
CCATGGCACCACTACAATGAAACTTTCATGCTGGCACTGTAGATTCTATGCTAGGTGGCA
TAGAAAGGGTTTGTTCAGAAAACATTTGCTTGGCTGTATGATACAATCATGTGTTAGGGC
CACTCAGTACCACCTCCTTTGATGATGCACCCAGTGGTGCAAAACGTGTCAGGGGGAAGT
GGCTACTGTGAGGGGGGAAGTCACTGCCTTGTGGTATGTTAAATCTGAAGGGTTTATAAG
TTGTTTTTATATGATTTGCTGTGAAGTTGTGCACTAACTTACACTTTAAAGGAACAATAA
CACCAAAAAATGAAATAGTAAATTAAATATAATGTACTGTTGCCCTGCACTGGTAAAAGT
TGTGTTTTTGCTACAGTAACACTACTATAATTTATATAATAAGCTGCTGTGTAGCCACGG
GGGCAGCCATTCAAGCTGGAAAAAAGGAGAAAAGGCACAGGTTACATAGCAGATAACAGA
TAAGCTCTGTAGAATACAATAGTGTTTTATCTGTTATCTGCTAAGTGCCTGTGCCTTTTC
TCCTTATCAATTTATTTGATATTTTGCTATTTGCTGCAGGACCCAGTGCAAGAAACATAT
GGCTGTCTTTTTTGTACCACTCTGCCAATACAAATTTTTCAAACAAAGTAACATTTTTCC
TGAGCTTTGCAACACCACAGGGCTGTAGTTATTTGAAGGATGTAAACAGCAGAGCCAGGG
CAGATGGGTTTGCAGGTTTTGGAATATAGCATATGGCATGGTATGATATGATAATTACCT
TATGTTATTATGTGCTACATTTATTTCATGGTGGCCATTAAGCACACTGCAGGTTCAGCT
GCTTCCTTAGTTTCATCTTGTGGCTATACACTGAGCCATGTGCTTACTGGAGTTATTCTC
ATAACGTGCACTCTCTCTCTTCACCTCTTGTATCGGTTATTTGTTGCTTTATATGTTACT
CTGTATGCCCAATGTATGTAACCCACTTATTGTACATTACATAATAATAATATCGCAGTG
TGCTTTACTGCAGCATCTTATTCTGAAGCCGAAGGCATATATAAATCACGGGAAAAAGAA
CACCGTCCACTGTGCCCTGATGGTTACCAAGCCGCACTGGCCCATACCGTAGGGTACCCA
CATGTGTCTGATGGCGGAGGAGGAGGGGCGCGGTATGAGGTGAATGCAATTCACCGTGGG
AGACAGAGCCCTATACTTGAGTAACACAATATCTATACTTTCTAGTTTTTCTTTGGGAAT
CCATCCGGCCCCAGAGAGATGAGCTGATCCCTCCCCCCGATGCTCCCTCCTCACTGACGT
GGCGCACACACACTTGCCCAGAGAGGCGCCTTCATATTCCAGCTGGCAGCCCGGGCTCCT
CATACACAGCTGGCACCCTCATGTGGCGACCGCTGCTGCTGCTGGGCCTCCTCCAGCCCA
TCCTGGGCTATCAGATCGACTGGAACAAGTTGGACAGGATCGCCAGGGGTAAAGTTGAGG
TAAGGAGGGCCCTTAGTTAACTGCACAGGGGCCATGAAGCAGACGGAATGTACAGAATAT
ATATATATATACACGTTCTGGTTTTCAAAAACACACTGCATTGCTAATTATAATTGATAG
TTTATACATAATACAAATATTTCTGCCATACAAAAATATTACTGGTAATTAACAAAAGGA
CTTATCGATAGACTTGAGGCACTTATTAACAGCTGTTAGTGTATTGCCAGCCATTGTGCC
TATCATATCTGCCTAACTGATATTCCTGTTTCTCTTCACAGTCCTGTGGGGGATGACAGC
TGAACAGGCTGAAAGAGGTAAGTACCTTTTCCGAATTCAATAGGGATAACTCTTTATAAC
TCTTTATAGGGGAGGGGGTTCTGCTTCTGAGTTTTGGCACAATTAGAAAGCTACAAATAT
CTACTAAATTGTGTGATCTGGGTATGTTTTAAGTAGGGAAACAGAGAGAAAAGAAATACA
TGAGGCAGGGAAAGCTGTGGGCACAAAACCATGTAGCGGGACAGGTTTGGCCAGTGCTGC
CGTCAGTCTTTTCAATGAAAGGTAAAATTCGTCAAACTGTCTGTTTAGACCCCCCAGATC
TCTAAATATGGTGCTGCAGATGCTGTTGCACTTACAGTCCAGTATCCTGATGGTCCCAAG
TGAGTTGCTTAGGAGGACCCATCACTTTGCTAAACATATAGTAACAGTAAAAACGTACAT
CAGTTAATATACAATCTCTATAGAACTATAACCAGAGTTAATTCATATATGCAGGAAACA
GGTTGGCACAGACAGTCCCTGCTAAATGCATTATTACTACAGTGCCCAGGTTATCAGGTC
TTGTATTACCTCAGTGACAGAATGCAAACTTAAATTTGACTTTGCAATTAGAGAATTCAC
AACAGAAGTGCAGACTTACAGAGCAGTGGTAACCCATAGCAACCTAACAGTTACATCAAA
CTACTTGGTTGCCATTGGTTTTTATTCCAGAATAAAACTGCACCTGTTTTATTAATTCCC
CCCAGAGAGTGACTCAGCCAATGGCTGCTGCTGTGACAAACAGGCAGGCTATGAACAGCT
CTCTAATCACTACCTTTGAGATAACTTATTATATCCATCATGGGTTCTCAGAATCACTCC
CTGCGCATCTGTAAATAAAGTTAAAGGGAAAATATACCCCCTTTTAGACATGAGCTCATT
TAGTTGGGGTTATGCAGAAAATGTACATAAACACGATCTAAGCTTCCAGATATAAATATA
AATGTGTTTTGTTTTACACAAACAAGTTGATTCCACAGATTGAAGGATGCCGTTATAATT
CTAATAAGCTGTATCCCAAGATTTTTTTTCAATGAAAAGTGAATTCTGGGACATGAAGCA
CATTTGCTTTCCATAGCTGGAAACACAGATTCTTCAGAAAGCAGAGGGACTTCCAAGTCC
CAGAATCCATCACTTCACAATGCAACAAGATAAGGGTGGGGTTGCATTACAGTGAGACTC
TAGGGAGCAATTGCTTACAAGCATGGTAACCCCATCCATTAAGCTTCTATCTTATGCTAC
TGCTCAAAAAGAACAGTTATAACAATGCTGTTTAGTCACGGATGTACTTTTCTTATCAAC
CTGTTGTCTATTCCAGGTGAAGGCCTTTGTCACAGATGACCTCCCTCTTTAGTATCCTTT
TATAACATTTGGTTACAGTGGTTATTGACACCCCAAACTAAGGATCTAACAATATTTTAG
GGTGAAGACACACAGAGCTACTAGTACTACTGATCATTTACTGATAATTGTCTCTACGTG
TGTGTAAAACGCAGGTTGGATGGCATACGCGTTGCTTCGGTTTGCCCAAGTCATCCAAAG
TTGCCTCTTAATGAAACTTCGGACTTCGGAAAACCAAAGCAATGCGTATGCCATCCCACT
GGTGATTTACATTCTTGCCGGTGGGATGGCATTTCAGGGAGATTAGTCACCCGCAATAGC
AAAGATTTATCACGGGCAACTTATCTCCCTGTGTGACGCTGCCCAACCAGGTTGTCTAAT
TCCATTGTATTGTATCAGGAAATATGCTTCTTAAAGGAACAGTAACACCACAAAATGAAA
GAGCTTTAAAGTAATAAAAATATAATGCACTGTTGCCCTGCACTGGTAAAACTAGTGTGT
TTGCTACAGTAACCCTACTATAATTTATATAATAAGCTGCTGTGTAGCCACGGNGGCAGC
CATTCAAGCTGGAAAAAAGGAGAAAAGGCACATGTTACATAGCAGATAACAGATAAGCTC
TGTAGAATACAATAGTGTTTTATCTGTTATCTGCTATGTGCCTGTGCCTTTTCTCCTTTG
AATGGCTGCCCCCATGGCTACATAGCAGCTTATTTATATAAATTATAGTAGACTTTCTGN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNCTGTTGCAGAGCTACTTTGCCAGCATTTATGGTGTATTTTTACCA
CTTATAGCACATATTTACCCTACGAGGTAACATAATTTAATTCCATTTATGAAACACATA
CTAAGGAGCAGATTTGATATGTTGTTTAGTCCTTGACCCATGGCAGTCATAACCTTGAGA
TGAAACACATTCCTGGTGCGGACCCTGAACTTGTACTGATTACATCCAAATATGAAGAAC
TTGAGGTAAGAGGATCGGAATAGAAAATGCTTTAACTCTCAGTCAGGGTCATTTATAAAC
ACTGGGCAAAATTGCCCATGCTCAGTAACCCATAGCAACCAAGAGGCTTGAGAAAGGGCT
GGAACCCGAAATGTTGCCTGTTCTGTTGGCATAATAAAAACACCTTTTTCACTTGATTCG
GAGTGCTACAGTGTGTTGTATTACAAAGTTCCATTTGGTCCTTGGCAGTGGGCTCAGCTG
ACAGCACCCAACGCTACAAGTGGTTGTTACAGGTGAGTATTACCAATTTGCATTTGGACC
ATAGCAACCAATCAGTGATTGCTATTTTTCAGCCAGCTCCAGGTTGAATAATAAAATCAC
ATATTTGATTGCCATGGGTTACTGCTGAGGTGCACATTTGCACTATTCCTGCAATATAGA
ATTGTTCATTCATATCTTCATCTGTTTATGTTGGTGTTTTGACACATTAAATGCTGCAAG
TGCATGAGAATTCCTATAGAGGGTGGCCTGATTTACCAGGAATGAGAGATTATCATTGAG
AAGCGTTTGTGTGCTATGAAGCTTAAATGCAATTATCTCCCAGTAAGGAAACATATCTGT
GCCAGAGACTGAGATATCCAGTGCAGCACATCATACATAGATTGCGATTACCAAATGCCT
CGCGAGGCAACTTCGGCGATTTGCCGAAATCGCCTGCGCAGCGTGTGCCATCCCACCGGC
GACTTACATTTTTGCCGGTGGGATGGCAGTTCGGGGAGATTAGTCGCCCATGACAAGGGA
GATTTGTCGCGGGCGACTAATCTCCCTGTGTGCCAGAGCCCTAAGTGTTTCAGGGCATTT
TCATTTAAGCCTCCTTCTAAGGTTTCATCTTGTCTGTTCTAATACAAAGGGTTAAGACTG
CACAGCTACTAGAAGCACCAACCATAGGATGATGGTAAACAAATTTCAAAGCCAGTTTAA
GTAAACCCCATTTGCTTTCTCCGTCTCCTGAGAAAATATAATTACTAAATTACTGTCACA
AACAACATAATGCATGCGTGTGTGTTCAGGTGTGTGATGTCAGGCTGTGCCCCAGGATAG
CTTCTTCCAGCTATGGATCAGCTCCAGGCAATATGACACTTTGCTTTTTAAGTGGCCTCC
CAGGGTTTGATTTTCAGATTTTCAGTGAAGGAGTCTCGGTAGAACTTTTTTCTAACAGTG
GGTAGATTTGCACCAGTGCAATAAGTAACTATTCAGATAATTGCTAAGTGTCTACCCTAA
GTTGCCCGTGTGTGCCATACTCTGCCTTCCCTAAGTTGCCCGCGTGTGCCATACTCTGCC
TTCCCTAAGTTGCCTGTGTCTGCCATACTCTGCCTTCCCTAAGTTGCCTGTGTGTGCCAC
ACTCTACCTTCCCTAAGTTGCCTGTGCACCATACTCTGCCTGCGTCTGCTATACATTTCC
TACCCTATGCTGCCTGTATGTATCATACTCAGAAGCGCCCCAGTTACCAGGGGCGGCAAA
AAGCCGCTCCTGGTAACTTTAAGAGCCAAATTTCCAAATAGTGGCAATTGCGCTCTCTGC
ACTAGCGATCTCACCGCCCCCGGACCCGCTCCTACGCTCAGAAGGTAAGCGCTGGGGAGC
TGGGGGGCGGCATCCAGGAGCCGCCTCAGGTGGCGATATGTCCAGAATCGCCCCTGATCA
TACTTAGCCTGCCTTATACTACCTGTGTGTGGGGGTTTGTTCTAGGAGTTTATCTTTTGG
AAATAGTTGGTAGGGGGTCCTTAAAGTGTGTATGTGCTGGGGGCTGCTGTGCTATACACA
GGGGGAGGAGCCATATGTATTTAAGAGTGTGGCTTAATATAACTTATGAGGGAAGGGTGA
TATCCCGGCAGTGAGTATAATGATTTCATTTTTTGGTGTGCTTTCACCATTAATATGGGT
ATGGTTTTAAAAGCTCTTGTGATAATATGGGTGTGGGCATAGTCAAAAATGGCTTCCATT
ATCGCCCCCCCACAACATAGGCCAGACAAATTCCATCCCTCAGTACCACAGAAGTTGAAC
ACTGCTCTAGGAGATAAAGTTGGAAGAAACTCACTGGCTAGTGTAAGTGGTCCAGGTGTG
TATGCCCTGAACCCATGGCATTAAGTAAAATCATATCAACGACCAACTTTTTCAGACAGT
TGCACTCTGGACAGGAGGTTAAAACTCTAATTTCTAATCCATTAAAAGAAAAAAAAAAAA
AAAAAAGTCACCTGCCACATTTATTGCGTTCTGCGTTTATATTCCTATTCACTATATTCT
ATGTAAACAATTTAGATATTTTCAACACTACCGATACATGAATAATGTTCAATTCTTATT
TCATTTCTCTGGATCACTATCCTGGCCCAGGTCCTGCCCCACTAAGGCAACTCCTTATTC
AGGATCTCTGACAGGCTTATTAGTAACATTATATGCTGGGGAGAGATTCTCTGGCACATG
GATATTTCAGGCACATAGTTTCCAAGGTTGTGTTTTCTATTTTAGAGCAGGTAATTGTTA
TGTAGCGTGTGACTTAGGATGTCCCCCTCAGGGGTGCTGGTTGCTTTTACATATAGAAAT
CATCTCATTTTCTTTAATAAAGTGGGTTTCCGACAATGTGCTTAGCAGTTAGTGCTAGAT
AATTGTTTATTTATTTTTAATAGCATGGTGAGATGGATATATTTATATATAAGTAAAATA
AACTCTGAGATTTAATGTCTCACCATACTATAAAAATGAGTTTATCACTAACAGATAATC
TTCAGGTTTTTAGCAGAAGTAGCAGAAAACCATTATCCCTGTTTGATAGAAGCTTGCTTG
GAGGCATGTTCCAAGTGAAAGAAATGATTTTGCATGTTCTGTCATTCTAGCGAATCCCAC
TCCGTGACATGAAGAGAAGTGAAATTATACAGCTGCTGAAAGACCTGGGGTTTTATAGGA
AAAGCAGCCCTGATGCTCTAGTTCCTGCTGAGTTCAAGATGGCACCTGCAAGGGCATCAG
GGGACAAAAAGGAAGACTTGTAGCAGCACTATGGCAATCAGAAAGGGAGGGCACTTTGAT
ACATTACCACAGATTAGGCCCCACATCTTTCAAACACATTAGCAATCCTACAGGCAGAGG
GTTAATTCAGAATCAAAATCCAAAATTGGAGCACTGAAACTGATATCCCATGGCAAGTGC
ATTACCTTAAGGGCTATGGGCTGCAGGGTGTTTTTATTGCTGCATACTGTGGTTCAAAAC
ACCAACTACTCACAATGAATCCCTTCTCAGTGACATCAGTAGGTAGGACCCTGAGTATCT
CTGCCCCCACTCTTACTGCATGTCCTAGTTTGACCCAAAGTAATTAAAACACCCTTAGAT
CATAGCCCTAATCTAATACATTCCAAACTAAAAGTGCAATGATTAGAATTCTTATTGCAT
ATATGCCATTAAAGTCTCAGGGTACTTTCTGCACACTGTCATTGGTTGCTATATTCCCTC
TCTCAGCAAACCTGCGCATTAGTTGTTTCCCAGCCCAATATGTGAGCACTACTGGAAAGT
CTACCTTCCACCATGTATAAGTCTGCTAGGTGTTCCCAAACTTTATTTTTTAGATCCTCC
TGAAAAGATAACTACTGGCAATGGCTGTTACCTTGGAAAGTGCTGCCCAATCTCTTTTCC
TGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAACGACGGACATATTTT
TTTCAACCGCAACAACTGTGTAGATATTAGACTACTAGCTGTAGAAATGTTGTGCTGTGG
CCAGCCTCTGAATCATTGGGCAACGTGGACACAGGCAAGTCAGTTAAAAGAACTTTATTA
AAATGTCAGCACATGCTGGTGTATAAAAAGAACGGACACAAAAGCTGTATTTGAGGAGTG
TTTAAAACTTTCAGGTTAAAACAGGTTAAACAGTTTACTTATACTGGCAAGTATACACAA
ACATGAAATGTAGCCACAATGGAAATGAATGTCTGTCAGTGTGACATATGTGAGCCTTAT
GTATACATACAGACCAGCGATCTGCATCTAACCCACTATACTAGGGCTGCACTATATAGA
AGGATAATAGGAGCTTTCTCTGTGGTTTAAATCTACACAAACTGTAAGTATGCATGTGTT
CACTAATTATAAGTATATTAATGCATATACTACACGAATACATATATTTATACACTAGCA
GGTGTATATATGTGTGTACCTGTGTGAATACACATTGAAATACACTTTCTAAGTAGATAT
ATATATATATATCTCTTAAATAATATATATATTTCATACGCACACATCGCAACAAAAAGG
TGCTACTTTAGTTTCTTAAATGAAAGATACCAGCATATTGCTTACCCATGCTTTAACATT
ACAGTGATTAAAAGTTACTGGGGCCCTTGGAACTGACACAGTTTTATACACTGTGAGGCT
GTACATCAGTACATATAAACCCGGGGCCGCAAACAGCCCCAAGGCTTGGCCATTCCTTAT
TTCCTGCTTTTAAACCATAAATCATACAGTGCAATGCCACAAAGTGGCTCCAGTGTAAAG
AAAAAGCAAGCCACCAAGCTCAGGCACTGCCCCTGCACTGCAAGTGTTGGTATCACAGAA
AGAGAACATGGCTTGGCTGCAGTGGGGTCAGACGCCATTTGTAAGGGTAAAGCATGGGAA
ATGGCAAAATGTTCTTGACAAACTACTGGTAACCAGAACTGTAAATAATATGTTGGTGCT
CTTATTTTAGTGTTTCAATAGTAGAGCATGAGTAAGCTTAGGTAAGTAGATCAGTGTTGT
TTCAAAGATGTACCTAAAAGTTAAACGGCACCGGAACTTTAAAAGGGGTAGTTCACCTTC
AACTTTTAGCACGATGTAGGCATCCATCCATATAATTTCTTGTTTGTTTTTTTAATGTTT
ACTTTTTTTATTCTGCAACTCTCTGGCCTGGAACTTCAACTGCTATCTGGTTGCTAGGGC
TCAAAAACCCTATAGGTCCATACATAACTATACCATACTAAAGGTGAACAAGCCCTTCAA
GACAAATTTAGCATTCAGAGAATGAGTCTGGCTTTTTTTTTTTTTTGGAGGAGGGGTGGC
TAAAGTTTTTTTTATTGCTGCATGATGTTAAAAGTTAACTTAAGTCAAACTAATAATACA
GTTACAGGCTGCTCATACAAATTAACATGCTGAAATGTAATCAAAGTGACTGTGGTAGCC
TTTGTTGTATTACAGTGTACCAGACATGTAAGGAGCATAAACAGCAATTACACAATAGTA
CATATAAACTTTCCTCTCCACAAGATTCCTTTCAACTGGAGCGGGAGAGCACTCTCACAA
AAAAACATTCCTAGGTACAAGAATTAGGAACTATAAAGTGCTATATTGTGTCTGTGTGTG
CTTATTTTAGTACTGCTACCCAGAATTCTTCACTAAGAATGAGCAAGCAATGAGGGCAGA
TGAATCCCTCTCAATCTACAAGAAGCAAGTTATGCTGCACAACAATTAGATCTGAAGTCA
AGCCACTAATAAATGTATGTAAGCACTGCTGGTACAAGCTCTTCTTCATTGATTTGCATG
CTTTGAGATAGGAAAGCAGCCATATTGCTCTGTAGGACTTTATTTTAGACCATACTATAA
ATATGTTCATTAATAAACCTCCAGTTTGAAAAAAAGGCTCTAAACAGATTCTTCCTTGGA
TTCCAACAAAACTCTATACCAGGGAAAGGCAAACTTTTTGCACCAGCTATTACAGAACTA
AATCTCCCACCATGCCTTGGGCACTGTATTTCCAAAACTGGAGCATATTCGCCTATGCCT
TCTCTAAACCATCAACCACCATGAATATTATATGTAGACAGGATTAAATAGATTTCTATT
AAATATATTAAAAAGAGACTATTCTTTAAAATAAGGAAGGAAAAGAGGATGCACCAGTAA
TGCGCTAGCTGCAAGTGAAGTGTATTCTGGGTCTCTTACGAAGTGTAGCAAAGTCTATGT
TCTGAAGCTTGTGGCAGTGATTTCTTAAAGGCCCAGCACTTACTTAGTGCTATTTAATAA
TAAAATCTAAATATATTAATTCTGTAGGGAGGGACAGGCATTTGAGGCAGTGATGGCATT
CCACTGGCACAGCAATCATAGTCCCAGTGTGCCAGAGAGACAGCAGAGGATCGCACTGCA
ACACATGCAAGCCTCTGTGGCATCAGGGACAAGAGGAAGAACATTGTTAAATATCTGAGG
GGGGCAATATACACAACTCTGAACAATCACCTGTGAAACCTCTTAACATTTATCTGTGGT
GCAGAACTTAAGTTGGTGGGAGCCAGAAATGTTAGCGCTGTGCCAGGGGAAGCCACAGAA
AGAGAAGGGCACGTTATTAAAACTCTGACTTGCGTAGACGCATCTCATGCCGCCGCAGGT
GGTTGTACAAGGACTGGACGTAAGTGAAGACACACTTGGAGTCTGGTCTCTTCCCCATGA
TCATCATGTCCTCCACCTCCACCAGAGGGACACAGTCCACAAGCATCCTACCGAAAAAAC
ACCAGTGCAGACAGTCATTTATGAGGGACTAAAGGTGAGGAACACAAAGAAACAAAGCAG
TTTAAGTGTAAGGAGATCATATCAGGCACAGACATGAACAGGGATGTATGGCAGCCTTAC
AGTCAGTCAGCTCTGCAATCAGTTTGGGCATTTCCAACAAGGACACAAAGCAGACTGAAA
CGGCTGCAGATATGCTCCATTTAGTAAGTTAAGTGTTGGCAGAAGCATTGCCTTCAACAC
AAAAGTTTATCTTTCAGCATTTAGAGACACCATGAGTCTGTGAAAGCAGAGTTGGGAAAT
TAAAGGAAAATATATCCCAGCTAAGAGACAGTGTTTGGCCGAGATCTTCTTTTCCTTTAC
CTCACTGTATACAGAGCTTTCCCTTGTGGAATGTAAATGGGAGCTACCTTACTGCCGATA
TATAAACTGCAGAAAACATCACTAATATTCTCAAAAATGTATGCCCTTGCTGCTGTGGTC
TACAGAGAATAACCTGACAGAGGGCCCTCATTGATTCTTATTCAGTCATACAAGGGTGCA
CAAAAAGAATGTTATTAACAATATTATAAGGCAGCCCTCTTGATTTAATGCATATGGAAA
AATAAATGGAGACATGGGGCAGCACCCCTTTAAAATTTGTGCCTGCAAGGATTGCTTTAA
CCTTATCTATACTATGGTGCACACTCAAGCTCTGTGATTCAGAATTTCCATTATTTGGTT
TATATCTCAAGAACACTCCTCTCTCCTCTTCACACCATATATGTGCATGCCCAGTGTCTC
GTACTTAACCATCTCCATGAATGGCCCTACCTGTAATGTTCTGCAGGATGTTGGGGCTAG
AGTGTTTAACCCTTGCACAGCCAGAAGTAAAACAGCAATATACTCACATGGGACCAAAGT
TATTTTGTAAAGGTCTCTACACAACAGGACCCTGTTTTTACATCTTTCTGAAAACAATAT
GCCTGAATTCAGAAGAATTTTTAACCAGTTCAGTAGAACTAAACTTGTTTCTAAGTCAAT
GTTAATGTGGCATGCTGCCAATTTATCTGCTTTTGATTTATAGTTAAAATTTCCTAACAT
TCTACCAGTACCGTGCTATTCTTATCCAGCACACCAAGGCATATTTATTATTGGGTGAAA
GGACGGTTCATAAAGGAGACATTTCTGTTCTGAATATAGAGCTATAGAATTCCCTTCTTG
TGATCTGTCCTTTCACCCTTTGAAAAATAAGGGCCTGTCTTTCCAGGCTCTGTCTAAACA
AATGCACAGGGGTAACAGTGCTTCTCAGCATACATTCCTGCCATTACTGTTTAAAGAAGT
CTTGGTTGGCTAATTCAGATGACAAGTTACTTTACAAACA
Chart Advanced