SelenoDB
Release 2.0
Chart Advanced
Sequence Report for SEQ00002549_2.0
Identity
SequenceIodothyronine deiodinase 3b (DIO3b)
SpeciesTetraodon nigroviridis (Tetraodon)
DescriptionGenome -assembly-
Sequence IDSEQ00002549
Sequence release2.0
External IDNone
Gene SPG00002553_2.0
Annotation
Prediction method(s) None
OrientationForward
Toolbox
Sequence
>SEQ00002549_2.0 # Sequence # Iodothyronine deiodinase 3b (DIO3b) # Tetraodon 
GATTACCACTGATGCACAGATTCCAAAATATGACACAAAGTGTCCTCAGAAAACCAGAAC
ACTAAAAAAAACCCCTCCACTGAATAAGCCGCGGGCCCTCTCTCTTCATGCCTCTCCTGA
ACTTGTCACTGTCTTTTGCCTCTTGTAGTTGCTTTAAGTTAATCTCTCCTTCCCTCTCGT
GCCCTCTGCTCAGAAACGGGACCTGAAATGACCAGCACACGTTCCCACTGGGGGCTCCAA
CTGATTCACGTGGGAGCAGCTTTGCATTTCGTGTCCCTGCAAATGAAAAGGGGAATAGAG
TAAACTGATGGCACAGACCAGGCTGCATTTTCATTCCTTTGAAACAGGGGTGTGTGATGC
CAGGATTCCGCAGGGGGTCTCACAAAGCCAAAGCAATAATGTGTGTAGAGTAGACAATTT
ATTTTATAAATGTAACACACTTTCTTTTAAACACCTCGCAGTACATTTCCCAGCTTATGA
TGGGTCATTGGACTTTAATTTTTGCATGTTACCTTGCACAAAGCCCAATATTTTCTCTAT
TTATGGTCCAGCACCAAATTTGAAGCCAAGCCCATCATGCAGCAGCTGTTAACAGCCATT
AAGATCACCAAAATCTTTATGTAGGCAGTTATGATAATTAATAGTAACATCTGACATTAA
TACTAATTTGGCTATGTTTCAGAAAATGTAACAAATTTACATTTACCTGATTTAATGTTT
GAGGTTGATGGGTTGTACAAATTATTTATGATGCAACTTGTATAATAATAATAATAATAA
TATAAAAATGAAGAAATGAACTGTGTGGACACTAAAAAATTATGACAAAGATTTATTGCA
GCATTCATTTATAACATCTGCAATTCTGCAACTTTAGTCATGATTAACTGTCAGCTTTAA
TTGATTGTTATTATTTGATGGTTTTATTGCCAGGCAATCTTTCAGTCCATTAGCCACAGA
TTTCTAAACCGCTAAAAAGAAAATCCGTCATTAATCACGTTTTACATCTCCGGCTGTCTC
TGAGTTAGCCTCCTTTGCCCCCGGCTTGCCTGAAGATCTCAGCCTTCGGTGTTTTGCTTC
ACCTTCCTGTCCAGCATCACAAATGCTGCCAATTGATGTTTGTCCCACTGCTTTAGCAGT
ATCCCGCAGAGACAACTCGGGGCAGAAAACACATCCAATTAAACACTGTTGAGTGCACAA
TGACCTTATGAGGACAAGAGTGCTTTGATTCTCCTCCTGGGGATTTAGTTTTTAGTAAAC
ACACACTGTAAACGTCACATTAACCTTTACTACCCCTCAAATATTTACACCAGAAATGCT
CATTTTGGTGTGTGTTTAGCAGGGGTTTACTTTGTTCCGACTGGGGAGAGATGTTTCCGG
ACTTTCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGCGCA
GGAGGTCCGTGCTATTAGCCAACAACACGCATGTTTTTGGAGGTTGCGCGTTTACTTGCA
GGCTCTTTCTGGCTGGAGCTTGCATGTCCCACTCATTTTCTCCAGGTATATCAGCCTCCT
CCCACCTCCAGCTGACTCAGGTCTCCAGGTGTGAGTGTGGGAGTGATGATAAGTGGAGCC
TGGAGTTTTGTCCCGTCTTTTTTGCGCCTGACTTTATAGTTTCACAGCTAAAATTCTTTG
AGAAAATTTGATGTATTTTCCCAGATAATAGGCTCTTTTTAAATGAAAGGCATTTAGAAA
ATTCCAATGTGTGTTTTCCCACACTAATCTACTTTTCTCTATGATAACTGACACATTTTG
TCTAGTGGTCGCATTAGTCCATTCAAGCGTGCGCGCTGCCAGTGCAGCACGCTCCCTGGT
GTCTACTCGTGTGACTGCTTCTGGAAATTCCAGAATGCATCCACCGTCTGGTTGGATGGA
CAGATGGATGGGTAGATGGGTGGCAACCGAGGCTCCTCACGGTGCCCTCAGTGGGATTTG
TGCTTGCTCCTAACACCCACCCACCTCCTGGCAGTCTGCACCACCACGACAGACGTGTCC
CCCTCCCCGGTTTCTCGTTTACATCAGCTGTCTGACCTCTGTATACGTGTATATTTTTAA
AAGCAGGGGTTGTAACACATGATCTCATTCCGCCTTCTCTTTGACTCAGCAGTCGCTGAG
ATAGAAACCACACACAGAGCTGGCGACAGCAGTTCATTCAAGTTGAGAGTGCTTTGCTTC
ACAAAGGTGAAGCCGAGAGGAGGGAGGACGTTGGTTTTCCTGCCTTCTTTCTATGCAGGA
GAGACGTGTCCAAAAACGAAATGTGAATAAAGCGGCGTCAACGCTCATCATAAATCTGTT
TTGCGGTTGCTTCTCTGTGATATTTTATCACTCGTGGTTTCTGGAAGAGCGCCACCTCAA
TAAGTAAGCAGCTGAAAAAAGAGGCTGTTTTCCCAGAGCCGCTGTGTCCTCGGATGAACC
TGCAGCCGCTGCCAGGATTCCAGCAAAGTTTAATGGAGGTGGAAATATGCCGGTTTGAAA
ACATCTCAGCGGCACGGGCAAGCGCGGCCACAGAAGGAGACCCTCTCTCTTTTTCCTACA
AAGCATTTCTGTTTTCCGTCGGTGAGAAAATATTCAGATTGTGGAGTGTTTGTTTCAGAG
GAAGGAAGGAGGGGAGAGGAAGGAAAGAAACGGCTTCATAGGGTCTGAAGGACAAAAGGA
TAACAGACTCATTAAAATGTCTCGCTCCTAAAAAAAACAGAGAGAGAGGGTGGCAGAATG
AGGACTGATGCATCAGCTGGTGAAATCATCCTCCTGCCTGCTGATGTAAATGAGCTCACG
CTGCCATATGCAACAGTCACAAAGCGGCGGCAGGAATCCACCTCAGCCAAAGTCGCACAT
TAGGATGCCTTTTGGCTGCACGGAGGGCTTTTTGTCACACAAAAGCCGCAGTAACGCACA
TACAGAATGACCTATTAATGGAAATGGATTCGTTTTAATGCACACTGAAGCCAAGTTGCT
TTCTAGAAATGGCTGCGACACACTGACACAAGCTTTTTGGTGCTGCGACTGATCACAGAT
TGTTACAAAGAAAAGTCAGAGAATGATCCCAAAATGTAAAATGAATTCCCTAAAGACATT
TTAAAGGAGCTATTTCATCCAGCCACCGGCTATATCACAACCTATCAGCACACGGTTCAA
CTCCAAGACATCTGCATGAGTCACCATGAGTGTGCACAGAGACCAGACAAATTATATCTC
TCTTCTGTGTCTGGTTTACGCTTACCCTGTGGTGAAATATAACATGGATTTACCGAACGG
CAGATTTGGGCTCTGTCGGAGGGGCGTGTGATCGGACCTGCACCCCAGAGCAGCCGGTGG
CACCTGTGTTTGCTTCCACGGCACGTCTCTGTGCTGCTGTAGCAAACATAATGCCGACAG
CCGGACGGCAGTGAAAGCAGCTTGGATCCATTTGCCCGACCTTACTCTTCTCCCTGCCGC
ATGCGTGCAGCTTGTGAAGTCTCATTTGTTTCCGTGGGTGGTTGGATTGTCCTCCGGCTC
CCCGGTGAGCTCACTGCATTCTAAAGAGGTTTCAAAAGTGTTTTACAGTCGCCAGTAAAA
GCTTGATATTCCTCAAAGGTTTTGTTGTCTGTGGAAATGTTCCGGTCACTTAAAGGCAGA
CTGAGGTGAAGAGAGGAGGACGGAGAGGAGGAGCCACCATTTATGGGGAAAAGGTGTTGA
AATATAAAGATCAGTGTCATTAGCATTAAACAGACTGGACTTATACGTTACTTTTTTGCT
CAGCTTTTACTTTTCAGAGCTCTTTGTTTCACATTTCATCATCATAGAGACGACCTGGCG
GGATCACACCAACGACCTTTGCGTCGCTATTCTGACCCCTGTACATCTGTTCTTAACGTA
GTTTTTGCTAAATGATGCTGTTGATTGTTTACAACTGTCCTGCAAAACATTCAGCCAGCT
TTTACTCATTTTAACCTTCAATAAGTGCACTTTAGGATTTTAAAATCTAACCTCAAATAT
AGTTGTTCATGACCTCATTCCTGTTTTAGGGGATCCTGGTTTTTACCTACAGATTTCGCC
CAGACGTCCACGTGGCATGCGCCTCTGTGCAAACAGGTGACTTTTTAGGATGGTAGCAGC
TCTTGAACGTGCAGAATGAATAAGGACTCTTATTTTGGGCCGCACCCTTGCACCCTTGGC
TTTTTTTGGCTGGGACTCAAAGCTGCAAAGTTGACAGAAGGTAATCCCCGCCATGTGAGG
CCTCGGCCCCCGTTTGGAGGCGGGGTGTGATTCATTCAAATCTGCCGGTGGTATAAAAGA
AAAGGGAGTCGCCAGTAACCCAACTTCAACCCAGAAGATCGTGGCGCAGCGCAGGACCAC
CTGGTGGCCTATCCAGTCTGATGATGAACACAATGAAATCTATTAAAAATGCTCTGGTCT
TTTTCGTTCTGCTGCCCCGTTTCCTGATGGCAGCGGTGATGTTTTGGCTGCTTGACTTTC
TATGCATAAGAAAAAGGGTCTTTTTCAGGATGAAGGAGCAGGAGGACGATGCCGTCGATC
CTCCACTCTGCATATCGGATTCCAATCGCTTGTTCACAGTGGAGTCCCTGAAAGCGGTGT
GGCACGGCCACAAACTGGACTTCCTGAAAGCAGCGCACCTCGGGCAGGGAGCGCCCAACA
CCGAAGTTGTCCAGCTGGAGGATCAGAGGCGCAGCCGCATCCTTGACTACGCGAAGGACA
AGAGACCGCTCATCCTCAACTTTGGCAGCTGCACCTGACCGCCGTTCATGGCGCGTCTGA
AGGCTTTCCAGGGCGTCGTGGAGCAGAACGCAGACATAGCAGACACTGTAGTTGTGTATA
TTGAGGAGGCGCATCCCTCCGACGGCTGGGTGAGCACCGACGCGCCCTATCAGATCCCCA
AACACCGATGTCTGGAGGACCGGCTCAGCGCGGCGCAGCTGATGCGCCTGGAGGTGCCCG
GTTGCCTGGTCGTTGTGGACAGCATGGAAAACTCCTCCAACGCCGCGTACGGAGCCTATT
TCGACAGACTTTATATATTACAGGAGGGGAAGATAGTTTACCAGGGGGGCAGAGGACCGG
AGGGGTACCGGATCACAGAGCTCAGAGACTGGCTGGAAAAATACAGAAAAAGCCTGGAAA
CATCCAATAATTTAGTAATTCATTTGTAGATTGTGACATTTTTTTAGAGCTGCTATGACT
GGAAATGCTGCCGGTTGTCCAATTAGAACTTATATAGAATAAAATGTTCAATGTATTTAT
TTTTATACATGGTCGCATCAGTGAAATAGAAACTAGGCTCCTCTATGTCTTTGGAATATA
AATGTCGGGACCTGCAGAAAGATCATTTTGTACCAGCCTTGTTTGTCAGTGAACCAATGC
ATTTTGTGTTTTGATATATTTTCTCTCTCTCTTGAACGCGCCTGGTTCGGGGACGTGCGC
GTCTCTCCTCTCCTCAGTATTTCTGTGAGGTTCGGTCTTTAAACGGAGCAGATCCAGAGG
ACCGACACTGATGTTCCGATACTGCAGATCAGGGTGGACGCGTTGCTCTCCGAATGTTCC
TAACCGTTGTCCTGTTTTATTGATAGTCTTTCATAATAAAACCCTGTTTCTTTGCTTATC
CGTTTGAATGAAAATCAGATCAAATTGAAAATTTTGCAGGAATTTCCCCTCTAAAAAAAC
AGTGGCATACATAATAACGGCAAGAAAATGAAAATCTGCTACAGGGAAACTTACCCTCAA
AGTCAAAACATTTGTATTTTCGAAAGCAGTCCTTCAAATTACATTTATTTGTCCCCCTTT
TTCAGCTCTCCCTCCTCAAATCCAACGCCTTCCCTGCAGAGTCCGTGTAATCAGATAGAA
AAAAACCTGGATTAGAACCTGGATCATCATTAAAAGTGTACACACAGTAATTATACAGTA
GGTCTTGAGTTTGCAAAGACACTAAAAGCCGAAAAAAGCCATGCTTTGTGCCGCGCAGCC
CCTTCCTAAGCCTCTGACCTCCCACAATTAAATGAGGATAATCACACTTGATCCTATTAT
GGTGAAAGATACATCCACCTATAAGGGACTAAACACACAAACGTTCTCAGGGCTTAGACA
CCGATCCCAGAGCGCAGAGCTTCAGCTGGGCGACACTGCCCTAACATCCGTACCCTGCTT
GTGGTTTCATTCTGTCACAGAGATGCTGCCTTGAGGTCACGCAGCCCTGAGCTCTGAACT
CCAGCCCCACATTCCAGATTCAATGCAATCATCAGCGAGTAGGAGGTCTGATGGAGTTTC
AGTCTTTCCAAACAACAATGGAAAAAAAGCACATCTCATCACCAAGAAGTCTGGTAAAAT
CAGACAATTTTCAGTTGAAATTTTTTTGTTCCCTCTTCAGAATCCAGACAGTTACCCCTG
GGGGAAGCGAGGTATACGAGAAACAAAGGTAAAACAGAGAAACGGAGGAGATGCTGCTCA
GTAGCGGCTCATCTGGAAGCCATTTCGCATGTACGGTAAATGAAATATAAGGGTATCCTG
CGTGGACCCCTGAAAGGAACCCTCTTGGAATTCCTCGACACTGATCTGGATTCTTTCCAT
GTGTGAGTTTCCATGGGAGTCGGGCTCCATCTGTCAGGGACGACAGGCAGGCGGGAACAA
AGGGTTAAAGGTCAGGGGCTGGTGGTTAGGCGCTTTTACGATCCGGGGGGAGTGCTACGG
ATCTTCTGAGGTGATTTTGTTTCTTCTTCTCTGGTACACTTAGAAGATGAGGGCCCCTCG
GTCCCTGGGGTCATAACTCCACATGCGAATGCCTGGTGCTAAGGGGCCAGGGCCCCAAAC
AAAAAGGTCTCTGTTGAACCTTTGTTATTGCTGGTTTAACTCCTGACCATTTAACCATGC
TTTTTTGTTGTGGTTGTTGTTGTTTTTTAGAAATATGCAAATTGAGAGCGAACTAAAAGT
GCTGTTACTGTATGCTCTGAACTAATATTGGCATCATTCACAGCCTGGGGTGCAGCGCTG
ATGAAAGACTTGGCTGAATTTGCTGCAGAAAGTAGCCAGCTGAGGAGAGTTTTCCAATGC
ATATGCTGATTTATTTTAACAATGTGTCTAGTCTCAGTTTTCAGGAACATAACAATAACT
CAGCAGGCGTCTCAGACCCGCAAGGAGCGTGTAGGCAAAGACTAGAAGTAAACACAGCAA
AGGTAGTAACCCACACTGTGAGGCAGAAAAGCCGCAAAGTGGAAAATAATGTGTTCTGCA
GCCTCGGCTCCTAGGATTGATGCTCAGAAAATTAAACCCGCTTACACAATATAACCTCAC
CTCATTCTAGCTCCTCTGCCACCATAAACAGAGATTAATGTAACACTATAGCATACGTAG
ATAATTTGCATTTTTTTCGGATTTAAGAGAAACAAAAACACCAAATCAGACTAGATTCAA
CGTTTTCTTTTCAATGGTTGACACCTTGTGGTTATCTTTTGACACTACATATCTTAATTT
TTTTTTAAAATGGAGCGTCTAATGGAAATTCCAGGGAGACCCAAACACACGGAACCGTTT
TGTAGGAAGAACCACCCAGTGGGGGCCACAGCGTGGCTGTCAACGCCGGCTTCTAACGAG
GGAACCGCCGGTAACTGATGGCGCGGCCACGGTGATGGATGTCCAGCTCAAACACGCAAC
ACCACGCAAAAGGGCCACGGAGAGGCGAGGAGATCGTTTGTCGTTAATGACATTAGTGCA
ATCGTTTAGAAAAGTCCTGCCTAAAACGATTATTCCCGTTCCGCCTCCATTTAGGGCAGC
AGCACCCTGTTTGCGTCTGATTTCGGTTGTATTTACTGACATATATACAACAAATCACCA
TTAAAGTAAAGCATTTGTGTGAGTTTTCCTATTTGCTTTAGCTGGTTCCTCTCAGTTTAA
CTCGTTTCCTTAAATAAAGCCGGTAGTTTTAGAAGAGCGCCGATTTTACGCTTGTCAACC
GTGTTGTTGCTGCTTTGCGCCACAAGAGGGAGACAGAGACTGTCAGAAAGAGCCTTCTGA
CAGAGGCCCTCACTAACCCTAATCCTAATCTTAACCCTAATCCTAACCCTAAATCCTAAC
CCTGACCCTTCACCGTAGAGGGGAAATACGTCTGAAGCGTCAGCTGAGTCGGTGTTTTAC
TGATTTCCAGCCCTACTATTTAGGTGTCTTGTTGGGAATGTTGGTTATCAACGTCTCAGT
GATTTTGGATAATATAATTTATTTAAAATAACAACTATTAAAATACAACAAACAACATAG
AAACACACATTTGGAGCATTCACCCTTCCTATAGGGTCAATAGGTCAATAATAATAGTAA
AAGACATTAATAACAAATCATTCCACTGCATAACAAGACTGATGCTGAGTGTGAACTGAA
AAAATTCGGAGGAATTCATTTCCCTAATTTCCACATTATTGAACTTCAAAAGTTATGACT
GAAATGGGTTTGTGTGTCATGTGTTAGAAAACCAAGCAGCGTGAACAGGCAGCAGAGTCA
GGAATTAGGTGCTCAGGCACAAAAACTCCAAACACTTCCAAGATTACCAATACATTAGAA
ATATAAAGACAATAATGAGAGTAAAAATAGAAATTGTAAGGAATCATAACGATAATGACA
GATATGAAAACTGGACAGCTTTAAAGAAAGAAAATAACCTGTCAACACTGTCCAGCAGCA
TTTGAATTCAAAAAGCGCAACCTCTCAAGTACCAATAAATGACTGCAAACTTAAACATCA
CAAACTAAACAGACCTGTTTAGGTGTTTATCTTCTATGATATGTGCAGCTGCAAAACATT
AATAAGATTTTTTTTAAAAATGTAACTTTAGCGCCGACTTCTTGTCAGAGTTCATGCAAT
ATTTAATCCTACCACAAGAGGTCACTAATTCCAACGTACTGGTCAATGAACGCTGAGTAG
AACGGCAAAATTTAGAGATAATGCAGTAGAATGCAAAGTATTTATACAAGTAATTTTCAG
TAACAACCATTTTTTGGTTACTTAAGTACAAATACCTAAAGTTTTCCATGGTTTTTCTAT
CTTATAAGTCCTTAACTGTAACTCCCGTAATAAAATACAACATACATGTTTGCCATCATG
AGGATATTTTGTTGAATTTTTTTCTGATACTTTCATTTGAAAATACATTTAGAGTACAGT
GTCACACACGTGTCCACGTCATCAGATAATGCACATGTACAGACAGATTCCAGTTTAGTG
TCGTCTTTTATGTAACAACCGTCTAACCATCAGAAAGGCTGTTTTAGGATAGATTTAGTT
TTAGCATTCAAACTGAGCTCCTTCCAGGTGGGAGACGCGAAAAAGCAGAAATGGTTTCAT
CAGATGGAGGTGTAGTGTCTCCCAAAGCTGGTGAGTCTAATCTTTTCCGGCAGGATGATG
TTTACAGAGTGCTCCGGCTCCTCCAGTGTCACGCCTCCTGCCTCCCTCAGCAGGTGTTCT
CTTTGTTGGCGAACAAGCCTGCTGTACCTAACGTTAGCCAGCCACGTCTCACAGCGACCG
AAGAACACGATGCCCGTGGTTCCCAGGATGACCAAGCATGTGATTAGAGCCAGCATACCA
AAGCAGACCAGCTGACCGTGGGTGACGAGGACGCCGCGGGAGTGGACCGTCTCCTTCAGG
GTGATTTTTAGCAGGTCTCTCTCAGGAGGCCTGAGAAGCTTGTGGAAGGTGTGAGCAGGA
AGGGAATAATGCTGCGGGGTCAGCGCGAACACTTCACGATCCACCGGCCTGGAGCTGACC
TTTGACCTTTGCTGCAGCGCACAGGTGGGCCCCTTGAACCACCTCGGGCAGATGCAACGG
AACGTTCCGTCAGGCTGACCAACACATGTGCCCCTGTTGCTGCACGGCGCCCCAGCACAG
GGTGAAGCGCTGGCGCTCTTGTTGCACGTGAAACCGGTGAATCCGTGCTGACAGGCGCAC
GTGAAGGCCAGGCCACGGCTTGTGCAGTTCCCACCGTTGAGGCAGGGGTTCGGCTGACAG
CTGTCAAGGGGGATCTCACAAAAGTCTCCGGAAAAACCAGGGGGACACGAGCAGGAAGAG
TAAGCCGACGGGCCATCGGCATCTACGCACGTGCCTCCATTCCGACAAGGAGAGCTGGAG
GACAGAGAGACCGGCGGTAAACAAAGAGCAGCACTGATAACGTTTG
Chart Advanced