SelenoDB
Release 2.0
Chart Advanced
Sequence Report for SEQ00002328_2.0
Identity
SequenceIodothyronine deiodinase 2 (DIO2)
SpeciesSorex araneus (Shrew)
DescriptionGenome -assembly-
Sequence IDSEQ00002328
Sequence release2.0
External IDNone
Gene SPG00002332_2.0
Annotation
Prediction method(s) None
OrientationForward
Toolbox
Sequence
>SEQ00002328_2.0 # Sequence # Iodothyronine deiodinase 2 (DIO2) # Shrew 
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNGGCATTTTCTGCTAAAAGTAAAGTAGTGCTAGATTCCAAG
CCTGAAATTCCAAGTCTTCTTTTGGGTTCTCAATTTCAATTTTTTGGGTCTCATTTTAAT
GATCAAAAAAGCAGCTCAGTGAAAGATATGTAATGTATATAATATATATATACATGTGTA
TATATATTTATTTAACCAAAAATAAGCAATGATAGGATCTGATGCTCACTAAGAAAAGAA
ATTCTTGAACAATTTTAACTTTGGTTCTGCACTTATTAAAATTCCCAAAGCATTTTGGCC
CTAGGCTGCCTTTCATTGGAATTTAAAACCTGCACATTACATTATATGGAAAAATTCAAC
CAACTGGCCACACCTTGGTTTGCATTTAACTCTTTCCAATGCAGATGACTAAAAACCTTA
ACATGATAGTGAAACCTGAAACAAGAACTTAAATTGGGGCAATGTTATGCAGATGTGAGG
TTCCAGATATCCTTTATCCTCTAGAATGTGAATGCATTTAGTGCAGCCACTGTGGGCAAA
GGTTTTCCATCCCGGACTAATGACCAGGTCCTACTAAACTGTTAAGTAGGAAAATGTTTA
GATGACAGAGTGATGGGGAAAATCTCTCCCACACTGGCTCAACTCCACAACTTGTTGATG
CACTTTCTTGTATAGGACATCTCAAATCAAACCTTCCACCCAATAGACTATTTTTGTTAT
TTAATAGATACAATTATTTGAAGATCAAAGTGCTATATATCATTAGTCATTCAAATGAGC
AATTGTGAACCACAAAAAAATAGCTTTGAAGAAATGTGATTTCTAGGATAAACAGATTAT
CTAATAGTGAAAGACTAGCTCTAAGTTTTGAGGTTCATTCATTTGGAAAAAATGGTGGAA
GAAATCTGAGAAACTATGTCATCAGATACAGTGCTGATTTTTTTTTTCTGCTTAAAAATG
TTCTTTCCAACACTCCTGACCACAAAGCAGGGGAAAAAGGACCCCAACAGTAATATTTTT
TTATTACTATGTGTAGTCTATGCTTTGAATTTTGCATTTAAAAAATAAAGCTATTTCTTA
AAAAAATAAAACTTTTTTTCTGATTTTCTTTTTCTGGTTTTTGTTACTCTCTCTCCCCTT
TCCATGTAAAAAATGCTTCTTTCCTTGAAATCAAATAAGGGAGAATTGGTTAAAAGCTAC
TGAATTTCTACTGCAAATGACTTCTAGTTTAGATTTGTTTTGTATTTTGGAGTCACACCC
AGCAATGCTCAGGGCTCCCGGCAGTGTTCTAGTTTAAACAGAGAGCAATGATTATCTGAA
CTGGGGTGAGTACATAGGAGTTGGGCATCAGTTTCTGAATGGAAGCATCCGTTTCTGAAT
TTACACTTTCTATCATTGTTGCTGGGATTTTGTCTTGCACAGTAGTTTTCCAGTACATAG
CAGTTAAAATATCATGTTGTCCCCTCCTTTCTATTATTGTCCGTTCTTTTATTTCATAAG
GACATGGGGAATGTAAAGTATCTTCGCCATATGACTAATACTCTTTTTTGCTAACATAGC
TTGTCATAGGAAAAAATAATTTGACTGTTTTATGTTTACTTTTCTAACTCTGATGTGTAC
TCTAAAAATAATTCATCCCAGAAGATGCAAATCCAAAACTCATCATGGGCTCAAGTGATA
GAGTTGGGAGTTTAAGGCAATAGGGAATGGTGAGGATTGTGTCTGGGGTACCAGATCCCA
ACATATTGTATGAGAATGGTGCCCTCTAGTGTTCAGCAGTGCTTGCCCTGCCCATTCATC
TAGCAGGACCGGCAGGCTCATTCAGTACCTCTGTCCTAAGTTTACTATGTGCCAGACATG
TCCTAACTGCCGGAAAATAGCAATGGATAAAGAAAGGAATTCCAGGTTCTGATGGAACCT
AGAGACACTCTCATTTGATTATTTCTTTTCGAGGCAAAAATCTCCATGCCAACCAAATAA
AATGCATCTGTGTACTGAATTTATCCTAGGGACACTCCAATTAATGATTCCTGGTCTAGT
CTTTTAAATTACCTCTGTAATCTTGCAGGTTTTAGTCACAGAGACAAAGCAGGGGAATGG
ACTGACCGCATATTTGTACCCCCCCTGTCTGGTTCATGCTTAATGAGAACTCTGGATACA
GAAGGGGAGAAAAATCAGCTAATTAATTCTCAATTAAAATTTGATACCCTCACCCCAGTG
TCTGACACTGCCACTCTTGCTTCCAAGAAAACAGAATTCCTGAAGGTGATCATTTAGGTA
AGTGAGGAAGGAAACCGAACATGAGTGGGACTTGTGGCACTTGGCCAAAACCTTGGGAGC
CCAAGAACCCATTCCACCTGCAGAAAAATGAGAAAGGTGATCCATGGAGCAGTGCTCAGC
ATCTTAACCGTTTCTTGCACGAATTCAAAGTTGGCTTCTAACCACTTAACTCTTAAAAAT
TTAAAGATTCCCTTCATTGTAATATATCACGGGGTTATTTTAACAGAAGTAGGGGGGATG
GATTTTAAAGAGCTCTCTTCTAAGGAATTTGTTTCTCAGCCTTATGGTATCTTGATGCAT
TTGGCAGGAAAGTTTTCGTTCAGTCTACATACAGGCAAAATGGCACTGAATCCAAATCTT
GCCACCTAGTCACACAGCTTACTTTCATATCTTTAAGATTTTCTTTTTCTTTTTTTGCAT
TGGAGAAAATAAGAAAGAGCTGATATGAAATTTCTGAAATGCAATGATGGTACCCAAAGA
GGTTGGGAACCTCACAACTCTGAATTTTCTTAAATCAAATCATGATTCAAAATGAAAGAA
CCTATGGCACAACTCTGATTAGAAAGTTATAGTATCAAAGCAAAAATATCGGATGCAAGC
ACTCACATCTTGCAGGAGAGAGCCAAGACCAACCTCCCTCTGTCCTACCTGTTTTCTGGG
ATCCCGTGTTTCCCAGCCCCCTCATACATGGATTATAAAAATAACAACAACAATCAGAGG
AGGGAGTTCTGCCCTATAAATCTTCATGTTATATTAAATTACTTTCCACCAAGTTTGGAA
GCATTTCCTGAAAACTGTCAAAGGTATTAAATTTTTTTTCCCTCTCTCTCTCTCTCTCTT
TTTAAACCACAAAGCAAAATTTCCACTGTCCCTTCTGTACTTCCCCCCCTGCAAAAAAAA
AAAAAAAAGAGAGAAGAAGTCGTCGAGTTTGTGCTTTTTCTATCTCACTGCAGATCTGGG
CCCAAGGTAAAGGCCCTCTTTTCTCTATGACGTCAAGATCTTTTACCAGATATGAGGCTT
TCTATTTCTCTATTGTCGCCAATTACCCAGGGATAGTATTAAAGAGGTTTCGAGGAGAAA
TCTCTTGTGGCTGTGGAGAGACACACAAGAGACCCTGTCGCGCACACAGTCGCCCGGATA
GCACCGAAGGGAAAAACCCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNCCAACTGCTGGGCTGCAGAGACTGGACTTGGTCTTGCCATTTCTGCTTCT
TTGAAAGAGGAGACAACTTGGGCTTCTTTTTAATTTAGTTTTTCTCTTTCTCCCCCCTCC
ACCCCAACCTCCCCCCCCTTTACCTTCCCCCACCTCCCCTGTCCCCCCCACCCCACCCCA
CCCTACCCCACCCCCCATTTAAATAAGAGGGTGAAGGGGAACCAGAAGGCACAAGGGGAC
TGACTCGGGAGGCAGAGAAGATGGGCAACCTCAGCGTACACTTGCTGATCACACTGCAAA
TTCTGCCAGTTTTTTTCTCCAACTGCCTCTTCCTGGCGCTCTATGACTCGGTCATTCTCC
TCAAGCACGTGGTGCTGATGTTGAGCCGCTCCAAGTCCACTCGCGGGGAGTGGAGGCGCA
TGCTGACCTCAGAGGGAATGCGCTGCATCTGGAAGAGCTTCCTCCTGGATGCCTACAAAC
AGGTGAGCCGCGCTTCTCCTTAGGCCAGGCGGATCAGGAGCACGGGGCATGGGGGGGAGG
GGGGAGAAGTGGGCACCCCATTTTGGGAGCCTGGTATTGATGCTTCTGAGAGCGCCTTTT
TTTTTTTGGCTTTGTACACCTGCCACATAAGTTAAGCGTTGAGGGACGACAGGTATGAGG
ACATAACGGCTTCGCATAGCTGAATGCAACTTTCTTAGAAGGGTTGCTAACGTCTTGTAG
CGATTTGTGGGGGGTAAGGGGGTGGGGAGGTAGAGTGGACTGACACAATATCTAGGAAAC
AGCAGATGGGGACCAAGAGAGGTTGCGGCATTGATTCCACCCTTGTCATCAGCTGGGATG
CTGAGTTTGACTTGATTGGAAACTAGGTGAGGTGCGTTAGGAAGGGCAGTCTGAGGGCAT
GGTACCCCCTGAAAATCAAGATAAGAAAAATAACTCCTAGAGTCGACCAGGGCTTAGTAA
CAGAACGGTCACAGCAGATGTGAGCTGGCTTCGTAGCCCCGTTGTTTTACTGGTAGGGAT
GAGAGCCGCTGAAAGCAGGGCTGTGTGCAGAGTCCTCCACAGATTCTGATTCCAACCCTT
TTGAAGTGGTTTTCAGACACTGAGTCCGGAGTGACCACATAGCGATTTACAAAGGAAAAG
AAGGAAGAAGGGCAGAAATCCGGACTTTGTAGGGGAAAGCCCATTTGCCTTGCTTCTCAA
AATTGATAAATTGTCTTAGAATGATCAGGTAGTTTCATGGGTTCACTTCAATCTCCAAGT
TATTAGGACGCATGTCTTGAACCCCGGAGGAGTGTTGCTATTTAGCTTCAGAAGTTGTGT
TCCGGGATTGCTCTCAAAACCGGAGTGAGGGAGCTTTGTTTGCAAGTGATGAATGCTGGC
ATTCCAGCTCTCTTTTGCTGCTTGGAGATGTTGGGAGGGCATCCTTAGCCTATTCTTAAG
GGGCAAAGTGGACCATTTTGCCACTGGTCTTTGTCAGTTTGTCCCTTGCTCTGTGCCCAT
CTACCTCCTGAAGGTCCCTGGGCTCAGTAAGAATGGATTCATTTGGAAACTGTGGCTATG
AAGGCAGACTCTCTTGATTTTCCCTAACAGTGTTTGGAAGTTCTTGTCCAGGATGCCAGG
GAAGGGAATCTGAGAGGAATACGGAAGCCTATAGGCAGAAGTAGACTAGGGAAAACTTCA
GGATACAAGGGAGAAGGTAATGAATGGGTACTCTGTAAATAAACACTAGAAAAATAAACC
TATGCACCAGGGAAAAAATGTGACTTCTAGTCAAATGGAACTTCTAGAAAATGAAACAAG
TGTTCCAGAAGGAACCAAGCTTAGTGCATGAGGGGGATTTTTACTACAATACAGGACATT
GTTACTGAGAGTAACGTGCAGGTTTGCCTTTCTTGTCTTTGAGACAGAAGAAAAGGGAGA
GCTTTTGTTAGTAAGTGAACATTCTCTTATAATAATATAAAATGATGCTCAAAGTCCTGT
GTGAACTCATTTGTATAATGTATTTGTGGCAAATGGGAATTGCCAGAAAGGAGACCAGTT
CATTTCCACAACCATGTATACTGAATGTGATATCTCTGATTTGTTCTGTGGTTAAGGAAT
TTGGAGCAGGGTGGCGACTGCACTATTATGTCAGGCATGTCATAAGATAGGAGTTTCTCC
ATCTAAAGCTGCATTTTGTGGGTATTATGAGAGAACATGACAGTGGCACTGGTCAGATAA
CAGCATATCAAACTCTTACTTTGGAGGAAGACAATTAACTTGTGTTCATATAAGCAAAGT
ACCTACATAAGAGAATTTTACCTATAGGGATATATATCTCTTCTAAATATCCCTCAAATA
AGCTGTGGGAATTGTGGTATTGCCTATAAATGTTCAATGAGGTTATTTCTGTTATTCAGT
AGCTACGTTAAATACAAAGTAGAAAACTCCAACAATTGTCTCTCTAATAAATTTTTTCTT
TTACTAATGTATGGAATTTCAGTTTTAAAAAGCTGTTGTATTGATGTTGCAATCTTATTA
TTCCTAGTACAAGAAATTAGAAGGATTTGTTTGTTTTATTTTTTCACATGTTTCTGAATT
TCTTTCCTGCATTATAACTTTTGTCAGCTGATGTGACTAGTTCCCAAGTTTGATTGCTAT
TATGTTTGCTTTCAGTGATTTATGAAAAAGCTACCATTAAAAGTTAAGTAGCAACCCAAG
AACCCCTGTATCTAGGGACAAGACACGATCGGGTGTGGTAATGAATGGAAACACTGTGAT
CACAGCCTGCAGTGATATTTGGTCTCCTTCTGTCTCCAAGTATGGCAAGGGTTGTTGGTG
GTTATAGTGGCATTTGAGGGTCACGCAGAATCCCTGGAACAGGTTGAATTACTTCCCTGT
TGGCTGCTGCCATCTGTTCCCCTGTCTTTGGGTGTAACCATTTCTGCAGGCGCCCTGAAG
GGGGGGGAAGGACTGTTAGAGATGGCATCATAGGATTTCACAATCCTGACTTGCATTGTT
TTGAAGCTGCCACACTCAGAGGCTATTTTCCAGGGTGAGGGGGTGTGTACACATGTGATA
CAAGGAGGATGTCATTCCCAAGGCTCCTTGTTGAGTGTCAGATACTTGGGAAGGTATTTA
GAGAAATTAGAATAGTAGTATTATCCCTGTGCTTGGTCCTTTTAAGAGTGCAAGAGAGAA
ACAAACAAACAAACCCTTCTTCATTAAAATGTTTAGTGAAGTTTAAAAATGACTTCATAT
GGAAGTTTTCAAATAATCTGGATTTCGTTTGAGGGAGTTTTCTACACGGGTTATAATCTA
AAAGAAAGCCTACAGAAACTTGTGAAAGATTGGGGTAAATAACAGATATTTTTTGAGAAG
TTTCCCCGTCAGTGTCATGCTTCTAACACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NGATGAGGGAGATAAAAGTCAGTGATGAGGGAATTACGTCTTACGTATGACCTTTCTGAT
CCTTTCAAAATAAAGGGACCCTTTGGGAACATCGGAACTTCAAGACCAATTAGTGGAAAT
GATGCATCTTGTGTTTGGTCATTAAATACTGGGCAGGTTTCTCTTTAGAGCATCTAATGC
TGGCAGGGAAAGAGGTACCGACCTAATTACCTTCCGCAAGAGTAAAAAATGCCTTTTGAA
TGCCTCTTTGGCAATATGTCTCATTAAGGACAAAAACCAAACACAAATCCTCTAAGAAGG
AGAAATTAAGATGATAGGTAACTTGTGGCCAGGAGACTTTTCTGTGCCACTGTGGGAAAT
TAAAACAAAGTTTGGGAGTACCAGGGGATAGCTTGTTTTTGTTCAACTTCTTTCCTGTAG
CCTAAATGTTATTATGGAAGCAAGTTTATTTTCTTCATCATTTTGGCTCTTTGTCAAGGA
ATGCTTTGCTCCTGAGGAGAACAAAGAACCTCCCATCCCTGACGACAATGGTGATTCTTC
CATTACCTTTCAGAAGAGAACATCCCTGAGAAAACTGAAATTCTCTATTTGAAACTCTGG
TTATAATAAGAATTAAATTTTCATGGTTATCAAATGAAAAACTAAGAAATGACCAATGAA
TTTATTTTAAGTGGTTTTTTTTTTAATGTAAAGCAAAAGCAAAGTTTTACTGTAAAACTA
GTTGTATTTCTTGATGGTTGCTATGTCCTCCATCAGTAGGATTTTAGCAAAGGTGGACAT
AGATTTTAATTATTACATGATGCTGATAAGAGCAGACACCTCATTTGCTCACATTTGGAA
CTAGGGAGTTTTTCCTTGATTGCACTGGTCTTATCTATGCATTTACTCTAACCTGGTCAT
CTTTAAAAACAGGATAAATATTTATGACATTTTTTATCTGCAGTAGCATCACCTAGATGT
GCAACAAAGATTAGAAAGGGTGGGCTACTTTTATTTCATGCACAGACTCACATTCCTAAA
TTATTCAACTTCAATGATTTTATCTATAACCCTGTTATGATTATACCTATGGCAGTGCAA
GGAGATTATTAAGTATAAATTTCTGCCCCGAATTCTACCTAGAATTACACTGACTCTCAT
TCATTAAATAATTCATTTATCAAAATAAAAACATATGGGCCAAAAAGATAGTACCATGGG
GGTAATGTCTTGTACATGGATGACCTAGTTCAATCACTGGCACTGCATACAGTCCTCTGC
ACTGCAGGAATGACCCCTGAGCACAGTCAGGAGTAAACCCTGACCATTGCCAGGTGTAAG
CCAAAGCAAACAAAAAACAAAATGAGAATATATAATATATATTTCACAGCTGATCAATTC
GAAATCTATCTTTCCATGCATCTACTGAAGAACATTATGTGCTTACTTACGTGATTATTT
CCTTAATGTTTTATGTGGAAATAAAGGTGTACTTTTCTAAATGATCTAACATCACTAGCC
TGTATTTTGAAGAAAAAAATTATGTGACTGCACTGCATATTGTCAGTAAGAAAAGGAGAA
GGTGCTTTGGCTCTCTAAGAAAATTAACTGCAGGTAATAATAGAGTCACCTGTAACTGAA
GCATTAGATGAGATTATTCAGTTGAATAGTCAAAAATAATACAAGGATCAACAGTTCTTC
TTGGGTTAGAGTGTAAAGATCAAAGACCCATTTAACAAGACCACACAATTATTCATAGGT
CTCAAAAAAATAACTCATAAAAAGCATATGGATGCTCTAATCTTTCCAAGAATCTGCACT
TTGGTAGTTTGCAGATGATTCTCTGGTGGATAGATTGTTCACTTAACCAGAAGATACTTA
ACAGTTAATGGAGTCAGATCGACCTGAACGTGTTCAGGTATTTTATTCATAGTGTTAGGA
AGAGTATAACAGTATTGTGAAAAGCAGCTCTCCTAAATTAATTATTGCTATTTTGGTGGG
AAAGATTTAATGAGAAGATTATGATAATGCTACCCCTCCCCCCCTACATAAATCTCCAAA
GAAGGATAAGAAGAATGCACGTGTTCAAAAAGTTTATAATACCTTTAAAATGCATATCCT
TATATTTCACTGTTATTTAAAACACCGGAGACAAGTGAAGTTCATATAAACAGTCTACCC
AAACAGCTGGCTTTAATTTCCCCCCTCTATTTAATGTCATTTGTAAATTAACTAAGAAAA
TTAATATCAGTAATATAACTTTTTTAAATAGTGACTGAAAACAAATGTGCTTATTTAAAT
CATACCATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGA
AGCCAATTCATCATTTGTTATATAATGCATGGTGTAGCATTGACAACAGAGTAGGATCGG
AAAGAATACCTGCTTCAACTTAATTATGAAGAGCGTTAACAGCTCTGCTTTCAATGATGG
AAGCAATTACCTTCTGTGACTAGACAGAGAGTGAGAAACACTTTTATTCTCTTTTGGGTC
ATTCTTTATACTGCCTGCCAAGATGCTGCTTTACTTTACTCAATATATATTTACTATAGC
CTCTGAAGACATCACATTTTATCAGCACTCCCTGTTTTCACATAGAATGAATTGGACTGA
CAAAGTACTTAATGTCATATTCTATGCTTCTTTTTTTTTGCTCACTTCCAGGTGAAACTG
GGTGAAGATGCACCCAATTCCAGTGTGGTACATGTCTCCAGTTCTGAAGGTGACGGTAGC
AGAAATGGTGCCCACGAGAAGACGGTTGATGGGGCCGAGTGCCACCTTCTTGACTTTGCC
AGCCCTGAGCGCCCACTGGTGGTCAACTTTGGATCCGCCACTTGACCTCCTTTTACAAGC
CAGCTGCCAGCCTTCAGCAAACTGGTCGAAGAGTTCTCCTCAGTGGCGGACTTCCTGCTG
GTCTACATTGATGAGGCTCATCCTTCAGACGGCTGGGCAGTGCCTAGGGATTCTTCTTTG
TCTTTTGAGGTGAAGAAGCACCGGAGTCAAGAAGACAGATGTGCAGCAGCCCACCAGCTT
CTGGAGCGTTTCTCCTTGCCGCCCCAGTGCCGAGTTGTGGCTGACCGCATGGACAATAAC
GCCAACGTAGCTTATGGTGTAGCCTTCGAACGTGTGTGCATTGTGCAAAGACAGAAAATT
GCTTATCTGGGAGGAAAGGGCCCCTTCTGCTACAATCTTCAAGAAGTTCGGGATTGGCTG
GAGAAGAATTTCAGCAAGAGATGAAATCTAGTTTAGCTGATAAAAGGTATGACTGTCATA
GAATTTTATTTTAATTATAAAAAAGAAAGAAAGCTAAGAACTGAATCCACTATTTCGACT
CAGTCCCAACGCCTCACAGAAAGACAGGAATGTATATGCCAGAAGAATATGAACCTCTAA
CATTTCAACACTTCTTTCACCATCCAAATGCCAGTTGGGTTAGTAGCTTGATCACGTCTT
TTTCTGCTGAGAAGTCTGGAGTGAAAGGGATCCAAGGTGAAGAGGAAGAAATCAGAATGT
GTTTTTATCTGCCTTGAGAAAGAAGTGGTCCAGCTGAAGGGTACTTTGGGACATGAAGAA
AAGATTGGTTTTCCTGAATCGTTACTGTGTTAGGGAAACCTCTGCCTATATGAATATGTG
GGATATTGCCTTAGCGTTACTCAGCATGGACAGAGTCCAACTGGAAAACTCACCTAATGC
TTAGTTATAATGGGTCTTACATCCCTGCCAAGTGTTTAGGAACTTGGTGTTTGATGTGTG
AGGAGTAGCTTCTGATGTTCAAGTTTCTAAGTGTGTAGTACTGTATGTCAGTCTGTATGT
TCCAGAATTCACAGGTATCTTTGATGATACCAAGAATGATTTCTTATCCTGAGTGTTAGA
ATGATCATTTGAAGTCTAAGGGTAACTTTCTAATCAGGTAGGGAAAACACTAGAAAAAAA
ATATCAAATTGAAAATATAGGAAAAATGAGGCAAACAGATTCGGAGACGTCTTTGGGATT
CTACTTTGAACATTGGACTTGGAAGTTAGACATAAACACATGGGATCATATGCAAGGTTG
AAAGAAGAGGCTTGAGGAAGAGGGGGGGGAGAGTATGTGTGTGAGTGTTGTANNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCATCTACTGAAGAACATTATGTGCTT
ACTTACGTGATTATTTCCTTAATGTTTTATGTGGAAATAAAGGTGTACTTTTCTAAATGA
TCTAACATCACTAGCCTGTATTTTGAAGAAAAAAATTATGTGACTGCACTGCATATTGTC
AGTAAGAAAAGGAGAAGGTGCTTTGGCTCTCTAAGAAAATTAACTGCAGGTAATAATAGA
GTCACCTGTAACTGAAGCATTAGATGAGATTATTCAGTTGAATAGTCAAAAATAATACAA
GGATCAACAGTTCTTCTTGGGTTAGAGTGTAAAGATCAAAGACCCATTTAACAAGACCAC
ACAATTATTCATAGGTCTCAAAAAAATAACTCATAAAAAGCATATGGATGCTCTAATCTT
TCCAAGAATCTGCACTTTGGTAGTTTGCAGATGATTCTCTGGTGGATAGATTGTTCACTT
AACCAGAAGATACTTAACAGTTAATGGAGTCAGATCGACCTGAACGTGTTCAGGTATTTT
ATTCATAGTGTTAGGAAGAGTATAACAGTATTGTGAAAAGCAGCTCTCCTAAATTAATTA
TTGCTATTTTGGTGGGAAAGATTTAATGAGAAGATTATGATAATGCTACCCCTCCCCCCC
TACATAAATCTCCAAAGAAGGATAAGAAGAATGCACGTGTTCAAAAAGTTTATAATACCT
TTAAAATGCATATCCTTATATTTCACTGTTATTTAAAACACCGGAGACAAGTGAAGTTCA
TATAAACAGTCTACCCAAACAGCTGGCTTTAATTTCCCCCCTCTATTTAATGTCATTTGT
AAATTAACTAAGAAAATTAATATCAGTAATATAACTTTTTTAAATAGTGACTGAAAACAA
ATGTGCTTATTTAAATCATACCATTAGCTGAATTTTCTAAGAAAGCAGAGTGTGACTTTA
AGATTTTCTTTAGAAACTTTATAGTATTTGTTTAAAACCTGCTCTGCTAAGAATTGTCAG
AAATGAGAGAACGGATTTCTTTAATTATTTCCTCACAGTTAAAATGAGTTATGCATTAAC
ATTAGATAGAAACATCTGAATAAAAGCTCTTGAGTGTTTTATATCCATTTGGATTGTCGA
GTCCTTAACAATTTACTTCTAAGTGGCTTCAATTAACAGTGGTGTTATATATGGCTTTGT
TTATATCAGGGAAATAAGTCAATTCAGTTGCAAGTGTTTTATAATATTAAGTATAGTGTA
TAAAAATCAATTGTCCTGCCATATGTTGTCCCTAATGTTATTGGCTTTGATTAAACCATT
CTAATGGGGGAGATTCAATTGTGTTCATTCAAACTGATGTAATTGGCTCTTATATGCTGC
CTGCTTTTTGCTATCAATTCACAGATCCAAAGGCCACTAAACTTCTTTTCAGTCTCTGTT
CAGCTTTTTATTTCAGTGTTTATCAATCTTTCTGACTATGGCCCCAATCTGACCTCTGTT
CCTTCCTGTTACCCTTCCTCCTGTCCTAGCATTTGACTCCTTAGTCTCATACTATGACCC
CCATTTACATCATTTTCATGACATGAAATGTTTCACTGTGGCCCTGTTGAATAATCCTGG
AACATATGGCCCCCAGTTGAGAATGCTCATTTAAATCACACGCAAATAGAGGGAACACAT
GGAAAACTCATCTTCTATATCTCCGTAGCCTTGAGTCTTTATAACTCAATGGTGTTTATT
AATAACATTAATGGTAGAACAGTAGATGCTTGTGACTTTCTAGGTTAAAAAAGGGAAACA
AATAACAGTGTATAAATGGGTTTGTCATTAAAAATTGAAAGTAAGATTATGGAAAGAATA
TTTTTTTTTACTAATAAAGATGGTGAGTTCCAGTTCATGAGTCACAAATAAAAAGTGGCT
AGTTAAGAACTCTAGGAAGATAATATACTAAGGAGAGTACAAAACTCATGAAGGAATAAC
ACTCGAAATGTAGCCTTGCCCAGGTAAGATGGTATTCTATTTCACATGTCTGCATGACAT
TGTCTCATGGCAGCCTAATCTCACAATTATTGCTGCATTAATTGATTAATCAGAGTGCTC
TTCTCTGTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAAATGTAA
CCTGATTGAATGAATGCTGGATAATCGTATTGGGAAGTGATTCTTTCAGAATCCTTAATT
GTTAAACTCTACAGTCAAGGCTTATCAGTGACCCACTGATGTGTATCTACAGAATTGTGT
TGAGATTTAGGTAGTCCCTAGAGAGGTAAAATTAAAAACTTGTTGCTGCTTACTCACACT
GTAGTCCTTAAATTTCCCATTTGGTCTACATGTACAAAACTGAAACAGGATGTTCGAGAA
GTTGGTGGGGGGATGAGATATATGTAATGCTGTGCTAGTTGACTGGGGAATAAGTTGCTG
GAAAAATCACCCTGTTGTGATTAGTTTTTACAGAAAGAGGTCTTGTGTATGTGAAGTTTC
TTTCCTTGAGGAAAATTCAATGGGGAAGTGAAGTAGCATGCATAAGCAAACAAAGGCATA
GGCTGAATATCAGGGATAAAAGATATGTTCATTAGAACATAGAAAAGCTACTGGGGAGAG
AGAGACTGTTAAAGTGTCAATGGAGAAGTGAATTGACAAAGCTCAGGAATCTTACAATAT
GTAGAATGGCTTGGTATTATTAGATAAATCCTGATAAATCTGTAATTAAATAACTTATTT
ATCGCAACATAAACTTTTATGGTTTCTTGTGATGTATCTTTCATAAATTTAACAAAAGCT
AATTTTTGAGATAGAGGGAAACTAATGTTTGACTGATATGCTCAAAGGAATTGTAAGATT
ATTAATACCCATCCCACCAACCCTATCTATTGTAAAGTATGTTCCTTTGAAGTAGTGTAG
CTCAGATATGCTCAGTTATGTAGACATATGTATACACACATGTATATGTCTATATAAGTT
TGAGTTACTAGTTAAAAGTTACCCATCCCCCTTTCCATAAGCCGTGTTTACATAGAGCAA
TCAGTTTAGCCTTATAAATATGGAATTGGCTTGATTTACTGAAATAGTTTCCAGGCAATT
TTAGATATTATCATAGCATCTGGATTTACTAAAGCATTCAGAGTTTGAAAGACTTATACC
TTGGAACTATTTAAAAACTTACTTAATTTTATTGACTAGAGAAAACAGTAACAACAAGTC
TCACAACGGATATGTTACTGGTGCCCGCTTTGGCAAAATCGATGAAAAACGGGACGACAG
TGCTACAGTGCTAGAGAAAATATTAGTAGAATCGACAATGACTTTCTTGAATGGGCATGA
AAGAAGTGCCTGCACAGTTATGTCTAAGTGGATGACACAGATATTAAAATGTAACTGATC
TCCTTGTCTGAAGATTAGTAACTCTGTCCTTACTTAGTGTAGCTAAAGTGACAGTCATGT
AACATGACTTTTTTGCATTCATGTTTCAGACATCTGGTTCATTGTCCTCAGCTTGTTTAT
AGAATGTGCTCCTGATTTTAGGTAATATCAACTTCTAATATTAACTGAATCAGTAGGACT
ACTGATTCAGTTAAGTTCTCCTCTTCCTTTACCAGAAATTCCTTATTATTTTCATCAAAG
AAATGGCAATAGCATGCTGTCTTTCATTTTGATTGAGACACACATTTCACTATATGTGAT
CCTGAATAAAAATTATATAGACATTGTAAGGTTATGTGCGGTGCTACCTTGCTTCACAAA
ATATCAAGGACGGGTTAAAGTCAATATTTATGCCTTTGGGAACATTCCTATCTGGATATA
AAGTACCTTCCTTATACCTTATGAACTAGGTGCATGGAAGATAACTGTATGGATTAGGGG
GAATCTCCATTTTATAAATTGTATGATGGTAAACTTGGGCATTCATTCCATCTTACCTCT
GACTGTTTGGAAAATAAGCATCTTCAGAGTCATCTGGTCAT
Chart Advanced