SelenoDB
Release 2.0
Chart Advanced
Sequence Report for SEQ00002208_2.0
Identity
SequenceMethionine-R-sufoxide reductase 1 (MSRB1)
SpeciesPteropus vampyrus (Megabat)
DescriptionGenome -assembly-
Sequence IDSEQ00002208
Sequence release2.0
External IDNone
Gene SPG00002212_2.0
Annotation
Prediction method(s) None
OrientationReverse
Toolbox Forward Reverse  
Sequence
>SEQ00002208_2.0 # Sequence # Methionine-R-sufoxide reductase 1 (MSRB1) # Megabat 
AAGAAAATTACCCGGTCTGATGACTATTTTGCTAAGATCACACTGGTTGGGGGAGGCTAG
CTAGGAACTGTCACTGTTGTGGGGGAGACCTACTGGCAAAGATGCGTGGGAGGTGGGACC
CCAGGAACTGGTGCACCCAGGGGGGCCACGATGGAAGCAGGTGCAACTTGAAGGCATAGA
AGGGCCACAGGAAGTGGAGGCCCGGGCATCAGTGCAGGTGAGTGCTACGCAGCTGCCCTG
GAGAAGGGGCTGGGGCTGGGGCTGGGCTGAGGCCAGGAGCGTCCTGCTTCCACCTGCGTC
CGGCCAACCCCTGCACTGTTCTCACCTCCTTCCTTCTTTCTGCCCCCACCCAACTCTGTC
TCACTCCAGGAGACTCAAGAAGGAGCACCCCAGCCCTCGACAGCTCTCCCTCGACCTGTC
ACTTTCGTGAAGCCCACGGAATGGAGCCCCGCTACCACCCGCAAAACCCTCAGATGCCAG
GAGATCTAGGTCTGTGTCGCGAGAACCATCACATTGGGTGGGCGTGGCCGAGGGGCTGGA
GCCCTGGCTCGAGGGGCCTAGGGGCGGGGCGGGGCGGGGCGCTGGGATCGCCCACCCCTC
CGTTATCCGAGCTGTCGCTGCTGCGCCTCCGGTGGCGCCTCGGGGAACTGCAGCGGCACT
TCGAGCCGCCTGAGAGCATCGGCGACGCGGAGCGAGCGCGTCCTCTGCTGGTAGATTCTA
ATCACAGTCCCTGCGACCACTCGCCACGCAGAGGACCTTGAAAACCGGAGAATCTGGAAG
GAAGTCATTGCACTGTGCCCCAACTAGGACTTCGTATGGAGGTGGGAGCACAGTGGCTCT
AGTCTGGCTTGGTGGTGACCTTCGCGGACTACCTCGGGCGCACCCTCCCACTTGCCTGCC
CTGCACTAAGGCATAGTCCGGGCTTCCCAGGACCGGGGTGCGCTGTCCTGCAGTGCCCTG
GCCTGCTGCTGCTGTTGGCTAATATTGGTGAATACCAGGATTCGTCTACTCCCTGAACGC
TGCCCTTGACTGGCAAGGCTGTGCAAGGAGGGGGCATTGGAGAGGAAGCGGCTGGGCTCT
CAAAGTCTTTTGCTTCTCAAGGAGAAACTGAAGCTGCAGGCCAGAGGTTATGGTGTAACC
CATAGGAAGAGGGATGGGGTGGCTGGGTAATTTAAGATTCCACATGAGACACCCATCCTT
CACCCGGCCCCTAGCAGACAGACCTTGCGCATGGGGTCTGATGTGAGGGGACCTCAGATT
CCCTGCATCCCACCCCCCACCCAGCTCACCCCCCATGGCTCTCCTGTGCCCTCATCCAAC
AAGGAAGTAGGCTGAGTTCCCTGCACAGGCAGGTGACCCCACAACAGAGCAGGGGCCCTT
GACCTGTGGCTGGGGATCAGGGGAAGGGCAGAGTCCCATCACTGAGATATGAGCAGGCCA
AACAGGCCAACAACACTGGAGAGCTCCCTGTTCTCCTCCCTCCCCAGCCACTCCAGCCTC
ATCGGAACACCTTTGCCCTCACATCTGCAGGTCCCACTCCTCCCTCCTTCCCATGTGGGG
GTACTCCCAGCTACTAAGTGTGCCTATTCCAATTATGCATTCAGAACTGAGGAAATAACC
ACAGGAAAAGTTTGGGAACCCACTGGACCCACTGTGAGATGAACCTGAGCTAAAACTCCA
TTGACCACCTGACCTCCACAAGCCCCTACTCTGACACAGTGACATTTGTGTCTCCTAGGT
GGTATCAGTGTAGAGCCAGTGTCCAGAAGTCCTGAAATGTTTATTTCCTTTTCCCCAATA
CACACACTCTGCTATAAGACTATAGGTCCCCTTAGGAAAGGCTGGAAGAAAGATGAACAG
TATGCATTTTGGCAGCATACTAAGGTTCTTCCTTAAGGGGTCCCTGCCTCCCCTTCATTC
AAGTAGTTCTGGGTCTGTAAACTGGTTCCAATCTGGGAATTGATTGAGGAGTCATGACTG
TTTTAATGATTTAAATTAGACTTTATTTACTTCACCTAGAACTCTTCTGCTCATACAGAT
TAATAATTCATTAGGCTTCCCATCTATTCACTTCTAGGGACACCATAATCAACTAGCCAA
CACCATAAGTTAGAGAGAGTCAAACTCTTCTGATTGCGGCTTTGACTCTGCTGTCCATTA
GGGTAACCATACCCACCTTGACTTTAGTGATACAATTAGCCCCGTTGCATTTAGGTTTCC
CAATTCCACAGCAAGCAGTTATTCTAAGTTCTGGCTCACACAGAAGTGATCACGAGCTCC
CTTAGGATGCTGGGGTTCCCCTCACAAATTTACTCCTCACAATGGTGATGAATGGCATAT
CCTCCGAATCCTCCCAGGGTGAGTAAGCTAATCTTAAATCACAAATCCACTCTAACATTC
CAATCTCCATAAGCCTTTGGATCCCTTTCTCTATTAAACCAAGGCAGGTCTGGCATTTCA
ACTCCATTTAGTGTGGGCTACCTTTTGGTCCATGTTTCAACCAACTAAACAAACTGTTAG
AACCCTTTCTAACCCACTGAGCTGCAATGTAAATCCAGAATCTATTTAGTGATCCCTATC
AATAAATTCAGCCTGATTCAACTTATGTTCTCCCGCACCCTTATCTTACCCTTTAATATC
CATTCCCATACACACTCCTCAGATTTCTGTTAACATAAATTGAAAAAACCATGTAGTTCT
TTTAAATATATCGTACCTCCTCATAGGTCACATTTTATACTCTCCCTACAGGGCTTGGAG
CAAGTTTGTTGCTGTCTCAGGGCCTTTGCATGTGCTGTGCCTCTCCTTGCTGCTCTCATC
TGTCATTGCTGAGTTGAGATGACCCCTCCCCAGCATCCTCCTCTCTGGAAGCAAAGCACC
AACCCCCAATCCCCCCTCCACACATCCTAGTATCATTATTCTGCTGTAGTTGCTCACAGC
CCTTCTTACCATCTGACATGAATTTACTTTCTCTTCAACTATGCCGTAAGACCTTGAGGG
CAGGCTTCATCTGTCTTGCTTACAGCTGCATCCCCAGCACCAAAGCTGGAACGTGGCATA
AAACAGGTGCTCAATAAATATTTGTGGAACAAATGAAACAACTGTGAAAAGCCTGGCCCT
TGTATTCTGGCATCTCCAATGTTGTTAATAAACAGAGCAGGCTTAGATTTCATTTGTTTA
TTCATCATCTCCTGATTACTCCAGAGAGCATTCGAGATGGGAGGGAGCATCACCCACCTT
CTCAGATGGTAAGAATTTCAGCATGTGTGCGGTAAGGCATCGTCATTGTGCCCTGGGAAG
GTGTGAACTGTAGTAGGCTGTGAGCTCCAGAACCCCCAGCCTTGTGCGGTCAAGGTGATG
GAGCAATCACTGCTTTCCTAAGCCCGAGTGAGGTAAGCAACAGCCACACAGATGGTGAAA
CAGGGTTCAGGATTTCTCCTCTCATAACTGAGAGACCAGAGGTCTGTCCTCTCGGCCCGC
TCTCCCCATGGGTCACGGATCATCAGTACTCTGGCTGCTTGGAAGGGTTTAACCAGAGCA
AATCACGTAGTGACTGGGGTTAGAGCAGTCGGCTGGGGACACCTCTGTTTGCACTCTGTC
GCCTAGCACAGACCGAGGGAGATGGACACCAGCTTTGGCAACAGCCAGAGCCCATCTCAG
AATTGAGCCCTGAAGGCGTGAGTCCAGACAAGCAAAGAGGGGGCAGTGGGCTGAGAAGTG
AAGGTGGGGGTACACTATCATTCACAGATGAGCCAGGCCTAAACCCATGTCCCTGAGGCT
CCTGTGTAAGTCAGAGGCCAAGATAAGCCAACAGCTGGGTCTGTCCTGGCAGTGGGATAT
AGGACACAAGTAGCAAACCAGTGCTTTTCCCAAAGAGAGCCTGTGCACAGCCAAAGCCTT
GGGAGCCTTCCTGATGTTTCAGCCACCCCGCCTTCCCCATCCGAATGTCCGGAGCTCCAG
TTCCAAGTGGGGAGAGCCAGAGTGTGGCCACCACGCAGTGCCCATCCGGGGTGGGTGAGG
GGTGCTCGCGTACTTCCTCTAGGAAGCTGAAGTTTCTTTGCCTGAAAGAAAAGAAGGAGA
GGAGAGAAAATCCAGTCCTGCTCAATGACGTCTCGGGACACCATTCCCTGTGCTAGCCTC
CTCTGCTCCAGCCTTCAGGTCAGGAAGTCTAGGAGAACCCAGGCACCCAGCTTTGGGGGA
GTCTGTGTACCCCATCCCAAGATCTGCAAGAGAACTCAGAGCCTCTTCTTCCCTCACACG
GACAGGGGATGAATACTACAAAAGGACAAAAGCATCATTGTACTTTATCATGCACCAGCC
CCTATGGACATCCTTGTTTAACTCCCACAATGATGGCAGCAAGCAGATGCCATCAGCAGC
CCCATTTTACAGAGGATGAAACTAAGATTAGAGACTGGCCATAGTCTTATAGGCAGCAAG
CAAGGAGCTAGGAGTTGAGCTACAAAGGTTGGGGAGGAGAATCAAGGGTGGCTAGATGTG
CAAACAGATGTGTGTTGATTTGTGAGTTTTTGTGTGAGCAGGAGAGCAAGGCCACAGAGA
AAGCTGAGCTCAAATAAAATGCACAAAAATGAAACACAGCTCCCCAAAACAAACTACCAC
TAATAAAAATACTGCCAACAGGAACGCATATTTGAGCTATTACGATGTGCCAGGCCCCAG
CTGCACAGCCTCGGCCCTCAACCTCTGCCCACCTGCCTCCCACTCCAGTCAGGGCAAGAG
TCAGGCCTCTGGATAAAACCCTTCAACACATTTGCCCTCAGATGTCTCCTTTCTGGGACA
CAAGTGATCAATCAGTCACAGGAGGCAGGAAATCTGTCCTCTTGTCCCCATCCTGAAGCT
ATCTTTTGGGGTGACCCTGGGCGGTCCTGGGCAGCATGCTTTGGTGACCCCATGTCACTA
TAAGTGGATGAAAACAGTGTTGCCCCACCACCACCAAAAGCCTCTAAAATATACGACAGG
CTTGTCTGTGCCATCTGCCTGATGGCAAGCTCACCTTTAGGGACAAACTTCAGAGAACTG
CTGAATATTCAGAAGCGGGATTGCCCCCGCTTTGGGCCATCGTTCAGGAACTCATGGCCC
AAACCATTGCCACACCTGCCGCAGGAGACCTAGGAAGACCACAAAACAGCCACGTGAATT
TCTGGACACAAAACAGCCACAGCAATGGTCTCTCCTGCCACCAGCAGACAGTGTCCACCC
CATGCCCATTTTCCAAGGTAACTGCTGGCAAGAGAGGGTTGATTTCCATCCTGGAGCCTG
TGCAGGAAAGTCGTCCTGTTTCCCTCTTCCCACCAGGACCCCAAGCTCTCCCCATAGCTT
CCCTGCCTGAGGCCAGAGAGGTCTGGGATAGACTCTAAGCCTCTAGAGCTGTGGAAGTAA
CAGAAGGAAGGAAGGGGTGGCCAACACCCTCCTCCCCTCCCCCTGCTGCTACCACCCACC
TTTAAGGCTTCAGACTGATTGTGATCTGGACGCTTGGCCACACTGTCAGCATGGATGGTC
TCGGTGAAAGCTGGCCATGGAGACGAATGTGCATACTTTGAGCAGCTGGAAAAGAGCTCA
TAGCCACACTTGGCGCACACATAGACACCTGGAGGCGGAAGGAGAGGCATAAGCAGAGAC
ACTGCCTTTAGCCTCTCTGGGATGAGTTCCCAAACCCTCAGACCCAGGACAATACAGCAT
CGTCCCCATTTGCAGAGTGACCTGCACACCTTCCCCACATCTCCATCTACCACCCCCAGG
CCTGGGTATTGGTCTGTGGAGGAGACACATCACTGAGCTCACATTTAGTGGTTCTTAGCA
TGTGCCAGAGACCAGAGAGCCACTTTTCACACTTATCTCATTGATTCTCAAAAGTCCTGT
GATGCAGACCTAACCATTGTATAGATGAGGAAGCTGAGGCTTGATGATCCAAAACATTCA
GCTAGAGGGTGTGCAGCCAGGAAGGAACCCAGGGAATCTAATCAGATCACAGCACTCTCA
CCCCTTGCAGGCCCCACACAGTGGGGGCTCTGACATAGCCAGCACCACCACCTAGCCCTC
CTCCTTTCCCAAGTGGCTTTCCTGCTGCCCAGTGAAGCCTTGAGCTGGACACCCAGCCAC
TGGCCTGCTCTTCATGCAGGAAGAGAATGGTATCAGCAAAAAGGCATCCAGGCCAGACAG
AGGGCCCAGGAAAACAGAGGGCCCGGAAAAATACATTTTGAACTATCCTCAAAAGGGTGG
ACAGGATGTTGCAAAACTGACTTGCAAAACAGGAAGCAGGTACTCCCCAGCCTGGGGACA
GCCTCACTTTACCAGTAACTGGAGGAGGTCACGAAGAGGAACCAGGAGCTACTGTGGGAG
TGGAGTTTCCAGCTTGGCAGAGCAGTCTGAGGGGCCCATAGCCAAAGGGTTTCTGGGGAG
GGCTTTGCCCAGAGGGTCTTATGTCACAGCTGACATCCATAGATGCCCGATGTCAGAACC
TAGCCCCCTAGAGGGCTGACACTCAACAGATCCCATGCCAAGTAAGTTGCTGCCTTAGTA
TGCCTGTAGCATGTTTTTACCCAATTAGTCCACTAGCAGGCAGCACAACCCAGAAGGGGA
CTCACCACGGCTTCTCAAAGCCTGGGGCCAGGGCTGAGGGCTGGCCATGCCCCATGCCCC
AAGCCCCCCACCCCCACCCCGACTCTCCCCTTCCAGTCCTATTCTGTTCAACTTCACTAC
ACTGGCCACTGGTGGCCTGGCAACACTCCTGGTTACTCAACACCAGGGCCTCTGCGCAGA
TGAGAGAGGCATCTAAGCCGGCATATTCAGATGAGAACAGGGCATTCCGTGCTTGGGGCT
TACGCTGCACGTCCCAGGAACGGGGAGGGGAAGGCCAGAGGTAACATCTGGGAGCGGGAG
CTGCCACGAGGAGGAGCAGCCCTGTCACAGGAGCTGTCCCTGAACAAGATCTTCCACCGT
GTCCCTCTGAAGTCTAGATCCTGACCCGTATCCCTGCCCCAGCGCACCACCCCCATGTGC
CCTGACCCCATAGATTTCCCCCCGGAAACGGATATGGTCGCACTCAAGGCCTTTCCTCCT
GGAGGACAGTAAATCTCTCTCTAATGTCCCCTCCTCTCAGGCACCCCTACTCCTCCCTCC
TCCATTATCCCCTTTACCCATATCCGAGCCCCCCAGATTCCTCCCTCCTCCATTATCCCC
TTTACCCATATGCGCTCCTCCCATGCGGTCACACTCGTCCCCTCCCATTCCCGGGGCTCC
AGGGCTCCATTACCACCAGAGGGCAGTGACGCCCCCGCTAATGTGCCCTTGCCCCTCTGC
CCTCCCAGAAGTCACAGGTTGTACCGGGCTCAAAGTGGTTCTGGAAAACCTCGCCCCCGA
AGAAGCTGCAGAACGACATGACGCCAACAGGACCGCTGCACGCTCACTGCCTCTGACAGA
TCTGAGGCCACACACACAAGATCCCTGGCATGCGCCCGGCCCCGCGCCCCGAGGCTCCGC
CCCCTCCTAAGAACTTGCCCTCTTCCCTTTTCCCAGCAGACCCCGCCCATTGACTGCTCC
TGAGCTGCGTCCCCGAGGCCCCGCGCCAGGGGGCGCCGCTGAGCTGCGCTGGGTGTGGAG
TGGCGGCCACGCGCATCCTGAGCCGCGCGCGCTCTCCCAGCCCAAGAGCTAAGCCCCGGC
CACCCGCCGTCGACTGTCCTTTCCATCCTCTCAACTCAGACACCGTGGGAAGAGTTGCCT
CCGGCCTTTATTAGACAAGGAGGACAGGAGAGGGTCGTGCGCCCTTCTTTCAGGCTCCTT
CCATCCTAAGCCGCCTACAAGTCTCCCGAGGTATCCAGCTTTTCCTTCTCAAGATGCTTC
TTCTGGGGACCCTGTGTGGGTGGGGGGCAGGAGGAGCGTTAGTCACAGGGGTCTGGCTCG
GAATACTGCCCCTGGCCAGCTGCCTACGTCACCCAGGGTAGGTCCTGCCGCCCCCCACCA
CCATCGGTCCCTCCTCTACCTTTTCTAGCAAGAATCAGTGCCCAGGGCTGGACTCCTAAA
ATCTCTCTCCTATGGATGAGTGCAGGGAGCCTCCCGCTACCCCATCTGCTCCTGCTTCCC
CATTCTCGGACAGATGGGATGTGAGGTTCGGTCCCAGAGAACAAGGGGGATTGGGCTCAC
CATGAAGACCCTCTTCTCTTGGGCTGTCTGGAAGCAGCCATGTCCGAACTTTGAGGTAGT
GTCAATGAACTTGAGTTCAATATTCTCCAGGGCCCGGCGACTGTGGTGCACCAGGAGGGA
CTGGGACCGCGGCAGAGGAGATCCTCAAGACAGAGGTCCCCACCCTCAGGCAACCCCCAG
TCTACTCACCCATCTCCTGCCAGAATCCCTCCCTTTTTTGCTCTCCCCATCTCCCACCTA
TCTCTGTCAGTCCCCACCCCTCCCCACATTCCATGGGGCTCCTGNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNTCAGGCCTGAGCTCTTGGGGCATAGCAACACCCACA
CACCTGCCCACACATGTACACCAGGCCCCCTCAGCCAAACTGGCTTCCCACCCTTACCAG
TGGTGTGATAGACTTGTCAGTCACGTCATAGCTGGTAGACGCGTTATTCTTAACCACCTT
CCCGTCCTCCATATGCGGCCCTTGGCCAATGCGGTAGATCTGCCAGGAGAATAGGGCACA
TTGGGAGCAGCAGGTGGCCTCTAGGGCCAGAGGTGTGTCCACACCCATCAGCATGTGGGC
TTAGACCCAGGCACCAATGGGGACATTTCAGAGCCTTCGGGGAACCAGGTCATATACCCC
ACCGACAGGTCTGGTCACAGCACGTCCCCCTCACCAGCACTGTGGACACACCTTCTTGTT
GAGCTCTGTGCGGTGGTGGTAGCCCTTTTGCCCAGCACGGGCAATGGAGCAGCCCACACG
GGCAGGGTGCCAGGCACCGATGCAGGCCACCTTTCGCAGCCCCTTGTGGGTCTTCCGAGG
CAGCTTCTTGGTATGCCAGCGGCTCGTGACCCCTGCAGGGAGGAGGAGCTAGTGGGTGAG
AGGCCAGTCTGGACCCCATCCCCTCCAGGCAGCCTTCTAGGAGCTGCCATCTCGCCTGGC
CCTACCTTTGACGCCCCGGCCCTTGGTGACAGCAATGACATCAATGACCTCACTCTGACT
GAACACGCTGTGCACCGGCACCTGCTTCTCCAGCCGGGCCTGGGCCCAGGCCACCTTTTC
AGCCACTGTGCCACCATTCAGCTGGATCTCCATGATGTGGGCTTTCTTCTGCCGGAAGGG
CAGCAGCTTCATCTGTAGGACACAGCACGGCCAGTCGGTTCCCAGAGGGTCACGCCCCCC
ATTTGCAGACATGGCATGACCAGCTGATGACCCTTGGCAGGCTTGCATGCCTTCATTCAT
TCAGCAGATGTTCCTCTGCCTGGTCTGGCTGTGTGCCATGTCCTGTGCTAGGTATGGGGC
ACAGCATGGAATGAGGCAGACAGGTCCCAGCCCTCATGGAGCCACCAACAAGTTAGAGGA
CAGAAGTCAAGTAAACTCTCGGAGAGAGCTAAGTATTCTGATGGAGTATCAGGGGGTGGA
GGGGACAGTATTGCACATGGGGTGGTCAGGGAGGGCCTCTCCAGGGAGGTGACACCAGTA
ATAAGACAGAGCCACTGGGTGAAGATCTAAGAGCTTTTAGGGCAGAAGAGACTGCATGTG
CAATGTCTCTGAGACAGGGAAGATGCTGAGGAGTTGGGGAGATAGGAAAGAGACCAGAAG
GTCTAGACCACGGGGAGCAAGGAGAGGGGAGTACAGGATGGAGTCAGGTGTGAACGGGAG
CCTAGCCAGACAGATCTTGTAAGGAGGAACTCGAGGTTTATTCCAAGAGCGGAGTTTGAC
AAGATTAGATTCACATTTTTAAATATCTCTGCCTGCTGTTGTGTGAGGTACAGGCTGTGG
GGACACACAAGTGGAAGCAGGAACACAGTATAATGCTCAACAATGAGTATTTATGGAGCA
CCTACTGCATACAAGGCTCTTGATGAGTTCTGGGAGCACAGCACTTAACAGGCAGCCGTG
GCCCCTGCCCCATGGAGCTCAAGGAAAAAGAATGTTAACCAATGACACAAGTAACCAGGA
ACTGCAAGAGTGAGCGTAACTGAGATTGGGAAGCTCAGGGCCTATGAAAGGTTTCCCTGA
GGACAAGACACCCAGGAATGTTCTAGAATAAGCCAGAGGGTTTTGGTAACCTTTCAGCCA
ACATCAAGCCAGGTGCCATGTACGATTCACACACACACTTGTGCCAAAACCCACAGGGAG
GCAGCCAGGCCTCTACACCGGACACTTGACAGGAGATCCAGGCCCTTCAGGGCATTTCAG
GGCCTTGGTTGACCACTGGGCACGGCCAATGCCCCACAGCCCTCAGAGCACTCTGACGTC
TAGCAGCCCATCCCTGAGGCTTTGGGAGGCCAACCCTTTGGGCCTGTGCCTGGGGCTCTT
GGTATTTTTAGGCTGACATTTACCAGGGCTCTGAGAAGCTGGAGTGAGGGAGGGTGAGCC
CAGGGTGTGGACAGGCAGATGGTATGGACAATGGTGTAGGGGACTGACCTGGGTGTGGAC
GATGACCCGAATGACCTTGCAGTACTTCTTCATGGCAGCAAAGTCTTTCTGGAGCTGCTT
TTTGCCATTGGCATCGCGCCACCTCTTGCAGGCCTTTGTGAAGGCTTTTTTCTTGCTCTT
GTGCCTGAGTCATGCACAGAGGGTGCTCAGAGGGGCCAGTCAGGCAGCTCCCTGGACCTG
TCCTGCCCCTGCCTGCCAGCCACCCACAAAGCATGGGTCTTAGAATTAAAAATGTTCTCT
TCCTTCCTCCTTTCCTTCCCAGGGGCCTACCCTGGGAGTCCCTGGGCTGGCTCCAGTCAC
CATCTTTAAGCACAGACTGTCCCTCCCTCTCTGGGCCTCTCTGGGCTTCCTCTGTAAACC
AGTCACCGTCCCTGCCTCCCGGGGCCTGAGGGTGCGTGGCAGATGCACAGGAGTTTGGGG
AAGGGGTGTGCCAGCCACCTGCATACATTGCTACAGCTGCTGACCCCACTTAAAGTGAAC
AGCTGGTACTGGCCAGGTGCCATGCACGACGTTCCTAACCCTCACTGGAACTCTGGGTGG
TGGACACTGTTATCCCCATTCTACAGATGAAGAAGCCAAGGTTCAGAACGGTCAAAGCCC
CTGGATGAGGGGCAAATTGATAACAATAGAAACAAGGAAAACAAGGCCAGCTGGCATTTG
CAGAGCACTTCCTCTGTGCTGAGCCCTTGACCCACTTTGCTCATCTAACAACAGCCCCAA
AATGCAGGAACCTTTCCCATCTTCATTTGATGGTGTCTGTGGCATGAGGTGCAGAGGTGA
TATGAGGCTCTAAGAGGTCAGCCAGTTTGCCTTGGTCACACAGCCCACACTGACACTAGT
GACCAAACTTGTCACCTCCCATAGAAGGCCAGGGCTGGGCTGTGTCTCTGCCTCTGTAAG
TAGGGTGATATCTGTGAGTTTCCTCAGGCAGAAGGGCCTTCCCTTTCGGGACCTATGCCA
GGAAGAATTGAAGCCTAAGAATGCCTTTCTTTCTGATAAATAGAGCTTGTTAGTTGGCTG
TTTCTCTTTTCACCCTGGCTGCTAGGAAGCTCGGAGCCA
Chart Advanced