SelenoDB
Release 2.0
Chart Advanced
Sequence Report for SEQ00002204_2.0
Identity
SequenceSelenoprotein O (SELENOO)
SpeciesPteropus vampyrus (Megabat)
DescriptionGenome -assembly-
Sequence IDSEQ00002204
Sequence release2.0
External IDNone
Gene SPG00002208_2.0
Annotation
Prediction method(s) None
OrientationForward
Toolbox
Sequence
>SEQ00002204_2.0 # Sequence # Selenoprotein O (SELENOO) # Megabat 
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGCCGGGGCTGACCCTGGCTTCAC
TCCAGAGTTGGGGGCACCCCTGGTGGTCCAGTAGACGTCATTCAGCACGGTCACCCCACT
CGGTGCACTCAGTCTGGACGGTCAGGTGTCTCCCAGTTAGACCTCCAGGGACGTGCTGGC
TGCTACGCAGAGCAGCCATTCTGGACGGCGCAGTTCCCTCTGCCCGCGCCAGCCCGCAGC
CGCAGCCCTGAGGTCTGAAGCCGGGGCTCGCAATCCGGGAGATGGGACCTGGCACTGGAG
CCCAATTCTCCCGGCAAGGCCGAGGGGCCGAACCGCGGAAGCGGACAGACTGACAAAACA
GCCCATCAGAGCCAGACTGTGGCGGGCGTGGCCCACGCAGGCGCAGTGGCGGCCACTGCC
CCCCGCCGATTGGGCAGCGAAGCGTGTGGGGCGGGCCTTCCGGTAGGGGCGGAGCGGTTT
CCGTCGCAGCGGCGGCGCTTATGGCCTCTCTCAAGGCTACGCTCGGGGCTTCCCTCGCGG
CCGCCCGCACCCTGTCGCCGCCCCTCGGTTGCCGCCCGCTGCCCGCGCTCTGCTCTGCTT
CGGCGGCCGCCCGCGGCGCCGCCATGGACCCGGCACCCCGCTGGCTGGCGGGGCTGCGCT
TCGACAACCGCGCCCTCCGTGAGCTGCCCGTGGAGACGCCGCCGCCGGGCCCCGAGGGCG
CCCCGTCCACGCCGCGGCTCGTGCCCGGGGCCTGCTTCAGCCGCGTGCGGCCCGCGCCCC
TGCGGCAGCCGCGCCTGGTGGCGCTGTCGGAGCCCGCGCTGGCACTGCTGGGCCTGGGCC
CGCCGCCGGACGACCACGCCGCCCGCGACGCACGCGAGGCCGAGGCTGCGCTCTTCTTCA
GCGGCAACGCGCTGCTGCCGGGCGCCGAGCCCGCCGCGCACTGCTACTGCGGCCACCAGT
TCGGCCAGTTCGCCGGGCAGCTGGGCGACGGCGCCGCCATGTACCTGGGCGAGGTGTGCA
CAGCCGCCGGCGAGCGCTGGGAGCTGCAGCTCAAGGGCGCCGGCCCCACGCCCTTCTCCA
GGTGGGCGCCCATCTCCAGGGCCGGGCCGGGCCGGGGCTCGGGGCTCGGGGCTGAGGTGT
GCTGAGCGCTGGAAGGCCCGCCCCACTCTCTTGGCCGTCTGTGGGGGCGTGCGCGTGCCG
GCTGAGCTGTCCTTCCAGCTGGGGGTTGAGATGTGACGCCGGGAAGATTGATCTCGGGCG
GAAAAATACGGAAAGAAGCGTCCTGGCAAGGATCAACTTGCGGGAAGGAGCCGAGGCCAG
GAAAAGTAGTGCTGCCGCCCCAGGACCCCGACTCCCCCTGGCTGGCTTGTCCAGANNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAAAACCTGCACACAATTATAGCA
ACTTTATTCACAATTGCCAACACTTGGAAGAAACCGAAGTGCCCTTCAGCCCGTGATGGA
TAACCGAACTGCCGTCCACCTGACAGGAGATCCTCAGCACAGAAGGGATGAGCTCTCGAG
CCGCAGGGAGCCTGCCGGAGCCTTTGGTGCACGTCTGTGAGTGAAAGCCCAGCGAGCGGG
TGGCACGCCGTGCGACTCCAGCTCGGTGACATTCTGGAGACGGAAAGAGTCGGGGTTACA
GGGTTAGAGGGGAGGAGTGGACAGGTGGAGGACAGAGGACTTTTAGGGCAGTGAGACTTC
TCTGCATGACGCTCATGGTGGGTACGTGTCATACGTTTGTCAGAACCCATAGGACATTCA
ATACCAGGAGTGACCCTACTGTGAACTGTGGACTCTGCACGATAATGACATGTCTGTGTC
GGGTCATCGGTTATCGCGGACGTCCCGGTCCTGAGGGGGACGCTGACAGTTGCAGAGGCT
GTGGGAGGGAGGGGACGGGATATACAGGAAGAGCACCGTCCCCTCAGCCTTGCTGTGAAA
AGCTGTCTGCCAAAACATGCTAATAACAGAGGCCCAGTGCGACAAACGCTGCTGCCGTGT
GTGTCCCTGTACACGGTTTGTAAAACCAGTCCTAAAAGCAGCTGCAGGTCCACGAGCGTG
TGTGTGACACGGTGAGCGGGTGGACCTGCCCTTCACTGTCCCTAGCATCAGTCCAGCCCC
GGCTGCAGGCCGGGCTTGTCACCGTGCTGTCATCTAAAGTAAACTCTGACGGTGACGTTG
GTGCTGCTTGTGAATTGTGTTTGAAACAGCTTCGGCGTGTCCATTCAGTCTGTCCCTCTC
GCTGCCCAAACTGCAGGGTCAAATGGACGCCCGCCTGAGCGGCACAGTGACCTCTCTGCT
TGATTCCAGACAGGCCGATGGCCGCAAGGTCCTGCGCTCCAGCATCCGGGAGTTCCTGTG
CAGCGAGGCCATGTTCCACCTGGGGGTCCCCACCACGCGGGCAGGGGCCTGTGTCACGTC
GCAGTCCACGGTGGTGCGTGACGTGTTCTATGACGGTAACCCCAAGCAGGAGCCGTGCGC
GGTCGTGCTGCGTGTAGCCCCCACCTTCCTCAGGTAATGCGGGGCTCTCGCAGCCAGAGG
CACCTCGGTGACACGTCCAGAACCTGGCCCTGGCCAGCCCTGGCACAGAAGCAGGGTGCT
GTGGGGGAGACGTTTTGCACTCAGGGGGAGGGACTGACGGGCCAAAGGCACTGGGCACTT
TCTGGGTTGGGAGCCCTGTCCTGTGTGGGGACAGCCGGGCTGTGCCCTTCCGCACTGCGT
CCTGGCCCTGTGTCACCGGGAGAGCTGGGGTGGTGGTTCAGTCGTGGCCAGAGCTCAGCT
GGCCCAGGAGAGGCCTGAAGGGCCCAGGACTGCCAGAGGGGCTGTCCCTACACGGGCCCT
GAGGTGGGGTACATACAGAGCTGTTCACTTAGACTTTGTGACAGGGAACAACATGAAGCT
CACCCAGCAAATGCTCTCGCTCTGCGTCATGATGACAACTGACTTGTCTTCCTCACCCAT
TCATTAATGTCTGATGTCACCGTGCTGCGTGGCATCAAACACAGAGTTATCAGGAGGTGG
ATGTGGTGATCTTGTGGCTAAGCCGTCCTGTGGGGCCAAGCTGACCCTGTACATATCAGA
GCAGCCAAGACAGCTCAGCTATCTCCAGGCCAGTCCCAACCTTTCTTGTCTTCTGAGGTA
GTGGTCCCCAACCTTGTTGGCACCAGGGACCAGTGCTCCTATGAGAATCTGGTGCCCAAT
GGTCTGAGATGGAGTTGAGGGGTGATGCCAGCACTGGGGAGCGGCTGCAAACACAGATGG
AGCTTCGCTTGCCCACCACTCACCTCCTGCTGTGCGGCCTGGTTCCCAGAGGGCGGTGGA
CCGGCACTGGTCTGCAGCCCAGGGGTGGGGGACCCCTGCTCTGAGGGATGGGGGAGCCAG
GAGAGAGGTCTGCCTTGTCCTTGGAGACCCAGGGCTTCTCCACGGTGGCACCACTAGGCA
GTGTGCATAGCAGACAAGCAGCTGATGCTGTCACCACACTTCAGTTAGCACTTGAGCGGA
GTGTCCTTAGCTGTGGCAGGACAAGCACAGGGCCCTTCTCGTCCTGTGGAGTCCGGGAGA
GACGACCGGGGCTGCGCAGACTTTGACTGAAAGTGGACAGAGCCACGGAAAGACTGGCCG
AGCTCGTTCGAGGGGACCAAGGCCTCCCCGGGGCAGGCGCCCGCCTCCCGCGTAGGCAGG
AGGCTGCGCTGACCACGGAAACCCCGCCCCTCCAGGTTCGGATCCTTCGAGATCTTCAAG
CCGGCGGACGAGCACACGGGGCGCGCGGGCCCCAGTGTGGGGAGGAACGATATCCGCGTT
CAGATGCTGGACTATGTGGTCAGCACGTTCTACCCCGAGATCCAGGCCGCCCACGCCAGC
GACAGCGTGCAGAGGAACGCCGCCTTCTTCCGCGAGGTGGGCGGGCCAGCCCCTCCCTGG
CCATGCTGGGTCTGCGGGCCTGATCCACCAGCCGTGGGCGCCATGCAGCTGCCCCCGCCC
ACCTGGGCTGCACCTGGGCCAGGGGATGTGGCCAGCGCCCAGTTCATCCCCGTGGCAGGC
AGGGAGGCGGGTCGCTCTGCCCTGTGGGCCTCCACATGTCCATCAGCAGAGCAGAGAGGG
GACCCTGCCAGTGCCCAGGCGCCCTCAGCTGCTCAAGAGGCACGGCGTAGGTGAGGCTGG
CAGCTGGGCCCTGGCCTGGGCGGGTGGGCCATCTGAGCCCCTCCCCTGGCCGCGGGGCAC
AGCCTGGACCTCGGCAGGTTTGCCTGTAGTCTAGGTACCTTGTTTGGTCGTCCGCTGGGT
CCAAGTCACGGGAAGTCAAGGTTTCCTCGTTTTTCTTGTGGGTAAGAGCCACTGTGAGCA
CCTGGGAGCCAGTGCGTGGGGACTGGATCCTGCGCGTGACTCCTCCAAACTCGTCTCCTC
CAGCCTCCCAGGGCCCTTCACGGCTGCATGCTGGACGAGAGGGCGGTGTGCTGGGGCGGA
ATCCCCATTGAACAGCTCGCTCCAGGGACTGAGCGAACAGGGGAGTGGGAGGCTGGAGGG
AGTGGACAGGCCTGTTTTGCTGCAAGTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTAAAAGGATGTTTTCTAT
TCCAGGCGCAAAGGGACCGAAGGGCAGGATCGGGAGCAGGTAGAGGGTAGCGCTGGCCCG
GGCTGTGCGGCCTCCCTGCTCTTAGGGTGGAGCCATCGGGGTCCTTGGGGACAGGCAGGA
GAGCGGTGGCCATGTGGGCGCTTGGGTGCTACCAGGGAGCTGCACTGTCCCCTCGGCAGC
ACCATGGTTCTCAATCTGAGTGGCAGGTATGACCCTGACCACGTGTGCAATGCCTCCGAC
AACGCCGGGCGCTACACGTACAGCAAGCAGCCTGAGGTGTGCAGGTGGAACCTGCGGAAG
CTGGCCGAGGCCCTGGAGCCCGAGCTGCCCCTGGCGCTGGCCGAGGCCATCCTGGCCGAG
GAGTACGACGCCGAGTTCCGTAGGCACTACCTGCACAAGATGCGCAGGAAGCTGGGCCTC
GTGCGGACCGAGCAGGAGGAGGACGCCGCGCTGGTGGCCAGGCTCCTGGAGACCATGCAG
CTGACCGGTGAGTGCGGGCAGCCACACGGGCTCAGAGTTTTCACCGCCATAAAATGAACA
GGACATGACCTTGACCCTTAACCTGTTTCCCTGTGCTCGCCAACCAGTGGCATTAGGTGC
ACTCACTGCTGTGCAGCTGTCACCACCAGCACCTCCAGAACATTCCATCTTCCCAAATGA
AGCTCCGTCCCCATTAAACACTCACTCCCCACGACCCCCCCACCTGTCACCCACTTTCCT
ACTTCCTGTCTCTGAATCTCACCCCTCTAGGGCCTCACAGAAGTGGAGCCACACAGTGCT
TGTCCTCTGTGCCCTGCTGGGCTCCCGGCTCGCGCTCGCGGCCCACCCCCGTTAAGCTTG
AACCATCTACAGATGGACCGTGCTTTGCTCGTCCACCAGCCGTCGATGGGCACTGGGGTG
GTTTTCACTGTTAGCTGCTGTGAACGCACATGTGCAAGTGTCTGAGCCCCATTCTCGGCT
CTGCACCAGGAGAGGGCTCCTGGGGCACTGTGCTGCACGACTTGCTGGTGGCAGCGTCGC
CGGTCCTGATCTCGGGAAGTGCCGAGCCGGCCACCTGTGGCCTTTCCATACACACCCTTC
GTCAGGTCGAGGCAGTTTCCTCCTCTTCCAGTCTGAGTGCCTGGGCCATTTTGTGTCAGT
GAGACAATCACATGGGTTTACTCCTTCGTCCCCAACTTGTCCGGGTCACTTTAAATTGCT
GTGGTGAATTTGAGGCCACAGGCGGGGCCTCAAACCGTAGACATTCATTTCTCACGTGCA
ATCCTGGAGGCTGTGAGTCGGAGGTCGAGGCGCCAGCGGACTGTGTGGTGCCGTCTTCCT
GCAGTGTCCTTCCGCCAAGGACACAAGTCCTGTCACCGGGCCCACNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNAAGTATGTTTCAGTGGCGGCCCCCGAAGTGGGAAATGGCTGCAG
TGACATTGCTCAGGGCCAGGGGCCAACCTCAGTGCCCACACTATTGTACCCATTTTACAG
ATGAAGAAACCGGGGCTGGTGGCTGAGCTGGGTAGGGGCTGAGGAACAGGCTAGAAGAGG
GTCCAGAGCCCTGGACCTGATGCTGACTAGGGCTCCTGCACCTGTGTTGGGGGGATGGGT
GTGGGCCAGCGCGAGGCTGGTGCCACAGGAGGGACATGCAGGGCCCAGCCCCCAGCACCA
AGTGCTCTGTGCTCCAGGCGCTGACTTCACCAACACCTTCTGTCTGCTGAGCTCCTTCCT
GGTGGGGCCGGAGGCACCAGGCCTAGACGACATCTTGACTGCGCTGACCACACAGTGTGC
CTCCCTGGAGGAGCTGAGGCTCGCCTTCCGCCCCCAGATGGACCCCCGGTGGGTATGCGG
GTCTTGTTTCTTTGGAATGTTTGTAGAAACGCAGGATGGTCAGGATAGCATGGGGGCATG
TGCACATCAGGGAACATGGGATAGTTTTCTGGGTACCTAGGGGTTCAGGGGGCTGTCCCA
CTCCCAGGACTCGGGGATAGTTACATCCCTGGGACACCAAGGCCCATTCGCTGGTCACAG
GGCAGGCCAGCGGTGCTGATGCTGGCACGGGCGAGTCACATGGGACAGGCTGGGAGGCTG
GGCTCTGCGCCCCAGCAGCTCCCCGGGCCAGCCCTCAGGTCCCTGTCAGAGCACGCTCTG
CACTGTCCCCCACTGGGTGTCGCCCACACCTGGGGAATACCTGGAAGTATGGCTGTAGGA
CTTGATAAACAAGCCAACAGATTGTGGTCTGAGAAGAATTTAGTGCAGCACTGGGGAGTG
AACTGAAGCTCAGGGTGCAGGACCTCCGGAAGGAAGCCAGTGAGACTGGGCGAGGGGTGT
CAGGCTGTCCCTGACCCCCAGACGCCTTTGGGAGTGGGGAGAGATCCAGCTTATGGTCAT
TATGGGAAGAGCTAACAGCAGTTACCTTCTCCCAGAGGAAATCATTGCTGGGTTGGGACA
AAGATAAGGGGGGCGCCAAGCAAAAAGATGGCACCTGACTCCTCTTTGGGATGGGTGCCC
CCCCACACCCCAGGGTCTGCCCAAGTCAGCGGCGGTCGCAGTTCCTCAGGCGGGTGACTG
GCAGGTGCCCCCACGTCAGCGTCATCTGTGAGCCGCAGGCAGTGTAGCAGGGCAGCTGAG
ACTGTTGCCACCGCCTCTGTGCCAGGATAGTCATCACCAAGGTGTCCGGCGGTCCCAGGC
CACGGCCCCAGCCAGTGGTGGGGGCACTGATGCCTGCCAAGCACACTCACGCGGCCACTC
CACGCAGGCAGCTCTCCATGATGCTGATGCTGGCGCAGTCCAACCCGCAGCTCTTCGCGC
TCCTCGGCTCGCAGACAAACATCACGAAGGAGCTGGAGCGTGTAGAGCAGCAGTCGCGGC
TCGAGCAGCTGAGCCCAGCGGAGCTGCTGAGCATGAACAAGGACCACTGGGCCACTTGGC
TGCAGGAGTACAGGTGAGGCCGGCCCCACCCGCCACCCAGTCGCGAGGCTCTGGGTGCTG
ACTGCCTGTAGTATCACCTCCCCCGGGGGTAGCTACAGACAACCCCTACCCAAGGATCCG
CATGGAGGACGACTGGGGGCTTGCATATGATTCCAGAGCCCGGCTGGAGAAGGACAGGGA
GGGTGCCGGGGACGCCGCCGCCTGGCAGGCTGAGCGTGTGCGTACCATGCACGCCAGCAA
CCCCAAGCACGTGCTACGGAACTACATCGCGCACAGGGCCATCGAGGCTGCCGAGAACGG
AGACTTCTCAGAGGCAAGGGCGTGCCTGTCCCTGCTGTGTCCCTGGGTCCCACAGTAGGG
GGTGGGCTGGGGAGGGAGGGGCACCCCCACAACCCTGCCTTGTTCCCCCAGGTGCGAAAA
GTGCTGAAGCTGCTGGAGACTCCATACCACAGGGACACAGAGGCCCCCGAGGTCCTGGAT
GCCACCGAGCCTGAGGGGGCGGGCGGGGCAGGCGGGGAGGCTGGCGGGCGAGGCTCTTAC
AGCAGCAAGCCCCCGCTCTGGGCTGCGGAGCTCTGCGTCACCTGATCCTCGTAACTGCCT
TGGGGCCTCCACACCAGGAGGCCCCAAGGCCCTGAGTCCAACTGAGTCCATGAGGCGGCA
CCTGCTGAGCAGCCAGCAAAGCACACCCACACCGCCTCTCCATGACAGCAGAGACGTCCA
GTCAGGACCTGACCCGTCTCTGTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNGGGAGTAGTACTTGAAGGTGCTGTAGGACTGCTGCATGATTATGCGAAGTT
GGGGTGCTCAGCCGGGCCCCAGGGCCGGGAGATGAGCTGGCTGCGGAACTTGAGAACCAG
GCTGAAGACGCTGTGGATGATGTTCATGACGGGCGCCGCCCTCTCCGTCAGTAGACCCCT
GGAGAGCAAGAGCCGAGCTGTGGGTGGGTGCGCGCGCCTAGACCCGGGCCGCGGCCCCCA
GCGCCCATGCCTCACCTGAAGACCGCCTTGTGCAGGTACTCAGCGTGGGCGCGCTGGATG
TCCTCCAGGTCGCCCACCACGGCCAGCCTGGCTCGGAACTCACACCAGGTGACGTGCAGG
ATCTGGCTGGCGACGTAGCCCTGGATGACCTTCACGAAGTGTTGCATCTCGTGCTTGAAC
AGCTGCAGCTGACGGAACTGCACGGAGCCAGCCGCGGGGCTCGCCAGGGCTGCACGGAGG
GCAGGGGTGAGGGGTGAGCGGTGAGGGGCGAGCGGCCACTGCCCCACAAGCCGAGGGCAG
GCTCCAGGGCGGCCTTACCTGTGCGTTTGAGGTGGAAACAGACGTCCTTGAGTGTCCACA
TCATGAGTTTCAGTTGCAGCAAGAAGGAGAAGATACCACTGTACCTGCTCAGGCAGCTCT
CGGTGATGACAATGTTGACAGGCCAGTCGACCTGTGGGGATGGGCCTGGCTCAGGGCAGC
CCGAGAGCAGCCCCTGTCCCAGCCCCTGTCCCACTCACACCTGGGGCCCTGCTGACCTTG
TACCTGAGCTCCAAGCAGCTCAGCACGTCGGGGGCGTTGGGGGCGAAGGCCTCGGGCAGG
AACTTGAGGGCGAAGGAGAGGTTGGCGGCGTGCGGGGAGTCGCCGTGCAGGCTGTACTGC
AGCGCCTTGCTCAGCACCGCGTTCAGCACCAGAGGGCTGAGCAGCTCTCCGGGCGTCTGC
CCCGCCCCAAGCTGAATGGGAGAGAGCACAGGGTCCTGAGGGTGTCCCGGCCACCCACGG
CCAGGCATGCTGCACCCCTCCACACCCAGGGGTCACCTTCTCAAAGAGCAGGTCGCTGAG
GGACTGGGCAAACTCGCCGTCCTCCATCAGCAGGAAGTGCCGCAGGGCCTCGAAGTGCGC
CTCAAGGCGCAGCTCCACGAAGAAGTAGTCCACCACAGCCTTGTTCACCAAGGAGATGCT
GGCAGGAGGGGCCTGGAGTCAGGGGTGCTGGGTACCATGGGCTGGGCGGGGATGCGCGGC
TGGGACACGGGCAGGAATACAGGCAGGAACTCACTGGGCGGCCAGAGGGGCTGTGATCGA
GTGCTTCATGAGCACTGGCAGCGGCAGCAGCTCACTCAGCGGCACCGCAGTCTCATCCGC
ATCCGACTGGCCCCGGGGGTCCTCAGGGAGGGCCAAGGCCCGTGGGAGCCCATGGTGAAG
GAGGCGGGCGATGGGAGGCTCCGCTGCACGACAAGATGGCCCAGGTCGCACTTGGGGGAC
ACACTGGCCAGCCTCCGCCAACCTGCCATGGCCAGCCCACTCACACATGGCCTCGTAGCT
GTCTGGGTACTGTTCCAGGCGGTACTGCCCTGCCAGGCCTGCCAGGTAGGCCTCCTCCCG
GGCCTGGGCCGCTGCACCTGCCTCCTCCTCCTCCTCCAAGCCTGGGCTGCTCTGGGTGGC
CACGCTTCCCTAAAACAGCCAGTATCAATGCCCTGCCCTTCACCTCAGTGGGAGGGCGGG
CAAGTGGCCACATGTACCTGACCCTGCAGGACAGACCCTTACCAGCCCTGAACCACAAAG
TGGGCGCCCCCTGACCCCCAACTCTCGACCTTGGCTGCCCTGACCTGGGACTTGGAAGGC
CAACTTGGAGAGAGATCCTCGCTGTCCCCATTCCTTCCTGGGCCCGAGTAGCACAAATGA
GACGGGAAAGGATGTCAGGGTCAGTGCCCACTGTGGGGCAGCACTGCCCCGAGTCCCAGG
ACAGCATACTTCTCCCCCTCCCCCCTCCCCCTCGGACCCACAGACATCACCAGTGACAAA
ACAGCTTTGGGGTCCCAATGACCTGGCTCCTCAGGGATGCTGTCTCCCAGAGCACCGGGT
GCAGCCACAGCAGACGGCGAGGCCTGGGGGCCACTGTTCTCCTTGGGGCCGGAGCCAGAT
ACTTGAGTGCAGGAGCCATCTGAAGCCAGTTCTGTGGGCAGCCCCGGCACACTGTCCCAG
GCAGGGCTCTGTGCTCCTAGGCTGACGCACTGACAGGGACAAGTGGTCAGGGGAGTGCTG
ACGGGGCCTGGCCTCAGCAGACTGGGCTTCCCCTGAGAGCAACCCCCAGCATCATGTGGG
AATGAGACACGTGTCCGTGGACGTTCCCACCGTGGCCGGGAAGGGGACCTCGTCCCACAC
ATTCTCCCCGACCCTGATTGCTGGCATCAGACACATGTCCATGGACATTCCACCGTGGCC
GGGTGGGGACCTCGTCCCACACGTTCTCTCCGACCCTGATGCTGGCGTCAGACACGTGTC
CATGGACATTCCACCGTGGCCGGGTGGGGACCTCGTCCCACACGTTCTCCCCGACCTTGA
TGCTGGCGTCAGACACGTGTCCGTGGACATTCCACCGTGGCCGGGAACTGGCCATCCCGG
AAGCATAACCCCCTGAGGGAACAGCACCCTCTGACACGTGCCCCATGGCCTGGCTGCTTT
CCTCCTGGGGGCAGTTGTTACTGGGCAAGTGTGGGTAAGGCAGAGCCACTTGCTCATCTG
GGACGCATGTGTCCAGCTGCACGTGCATGTCCCCGCACAGCTGCAATCCCTCACAACCCA
ATCTATCTCCTACAGTCTGGAGGGACCCTGGGGAGGCCGAAGGGACCACAGCTGGCCTCA
GGACGGTCCTGAAATCGTACTCCTGTGGTCCTGAGGGACCGGTGCCCACTGCTGTGGATG
GAACCGAGGAAGGCAGGTCTGAGCCGATGGTCTGCAGAGCCTCCAGCACGGCAGCTGCAG
CAGTGTGTGCAGGCTGCTCGGCCCCTTGGCCAGGGGGCAAGAAGTCTTGGAGGCTGAGAT
CTGCAGAGAACGGCCCTGGCACCCTCGCCTGCCCCAGGCCGCAGGCCCCTCCTGGAGCAT
GCTCTAGGGGTTGTGTCGGCCTGCTCGCGCTGTCCTGGACAGCCACACGCTGCTCTGCAC
ACCCAGGGTCACAGCTGCTGCCTCCATCAGGATGCTCGGAGCCTAGAGATGAGGCCTGAA
ACACAAGTGCATGTTGGTCTCTCCAGTTATCTGGCTCTGTCCCCAAGTTCAGTTTTGCAA
CCAGCACTGAAACCCATAAAGTGGGGGGCTCTGAGGACACAGGCCCGGTGCCCACTGTAC
TCCCTGGGGAGTGCAGGCCTGGGCACCCAGGCTCAGTCCTGTTACCCACCCTGGACCCCG
CCCTGGCCCCTCACCTGGGAGTGTGCCCTCGGGAGGATGGCTGTCGGCTCCAGGGACTTC
CCCTCGGACACGTCTATCAGCATCGCCTGGAGTTCAGTCAGCAGGATGTGGGGTCAAGGT
TGGGCGGCAAGGAGCAGAGCTGGCACTCAGCCCCGTGCAATGCAACCCACAGCCGCCGGT
GGCCACGGCCCACCACCCATGGCAGCACCATATGGCCCGAGGTGAGCACGGCCTCTCCCC
AGCACGCCCACTCTGAGCACCTGAGGAGGGCACACAGGTCCCAGGCAGCTTCAGGGGATC
CCGAGTCCCCAGAGCCCACGGGACGCGCTAGGCCCCCAGGCCGCAGTGGCACCTGCACGC
GCTCCTGGTCCTCCAAGAGGAAACGAAGCCGGGCGCTCGCCAGCCTGCGCCTCTGCGTCT
TCCACAGTGCCTTCTGCTCCCGCCGGGCCGCCTCCGCAGACAGCTTGCTGTAATGGTCCA
CCAGCGCCTGCCTGCAGCCATACCCACAGAGGACTGGTTACCAGGCACCCCACGATGTCC
AGCTGGCTCCCTGCAAACTGGGATGGGTCCCCATGGTGGAGCCCAGGCGGCAGTCTGCAG
AGCCCAGCACCCTGCCCAGGCTACCAGCTGGTCCCTCTGGGCCCCTACAGCTCCTGCAGA
GGCCTCGACCCACCAGTCATTCTGCCCAGCAGACTGGGGGCCTGGGGGCAGGTGCCAGCC
AGGGCTTGGCAGATACCAGAGTGAGCCCTGGGCAGCTAGAGGCAAAGGGACAGGCAGGGG
ATGGCGAGGCCCCCCAGCGGCCTTGCTCCTTGAACCGCAGACGGCATCGTCCTGTTTTAG
GGCAGAGCCCTGGAGGCCAGCGCAGAGGGCACAGAGCACAGCATGTACGTTCTACTCGCC
TGGGTTAATTCGAAGCCAGCCCCGGAGGCCGCCCCGAGGCTGCGATCCTCTCACAGGCAG
GGAGCTGGGTTCAAACCAGACTGGATGTTTCCAGTTTGGCTGCTACGGGCCAGGGCCACA
GCCTCCCTAGCCCATTTCCGCCACACGTGAAAAGGACGATAACCCCCACCCATACGCGCA
CGCTGACGTGTGTGCAGATTTACACATGTGGATGTCTGCACAAAGATAGCACGAAGCACA
CACGGTCACACACACTGACATGTTCACACATCGCTGGCTCCAGGCCTCAGCTCCATAAAC
AGCATCTAGTCGGTCGGGACAACATGCCCAAGGCCACGAGCAGGAAGGGACAGCCCTTCC
CACAAAGGCCCCCTCAAGACACGAGCCCTACTCCCCACCTGAGGGAGATACAGGGGAGGG
TGGGCCAAGCA
Chart Advanced