SelenoDB
Release 2.0
Chart Advanced
Sequence Report for SEQ00002141_2.0
Identity
SequenceGlutathione peroxidase (GPx)
SpeciesProcavia capensis (Hyrax)
DescriptionGenome -assembly-
Sequence IDSEQ00002141
Sequence release2.0
External IDNone
Gene SPG00002145_2.0
Annotation
Prediction method(s) None
OrientationReverse
Toolbox Forward Reverse  
Sequence
>SEQ00002141_2.0 # Sequence # Glutathione peroxidase (GPx) # Hyrax 
CCAGAACTAACATGAGTTCTCCTAAATTTTAAGAACCACCAATGTCCACATGCCCATGGG
AGAGAGACTGTGCTGAAGTCTTACCTTCAGGACTAGGGTGTTCAGCAAATCTGGGAGTGA
GGGATAAGAAATTATCTAAGTCCTCATTATCTGGGACTTAAAACTTCTGGAACAGGCAGA
GTAAAATAAGTAGCCACATCTTGAGTATAACTGGAACTATTAGGTTTCTTGATTCTGTCT
CCAAGTATGAGTCTACTGTTTCCCTTGCAGCCAGACAGCCAAGTGCCGTCGAGTTGGATC
CAACTCATGGCGACCTAGTTTCTCTCAAATTTAAAGACTTGTCTATGCTGTCTTTAAAAA
ACCCACTGTAATGGAGTCATGTCTGACTCATAGTGACCCTAGAGGTCAGAGTAGAACTGC
CCCATAGAGTTCCCAAGGAGCACCTGGTGGATTTTAACTGCTGACTTTTTGGTTAGTGGA
TGTAGCAGTTAACACACTAGGCCACCAGTGTTTAGGACAGTGGGAAAAAAAAACAAGCTA
TTATGGTCTAAAAACTGTTACACAAAAACAAAGTAATCGGGAACTTACATGGTAGCCAGG
CCATCTCTGGGCCCAAAACACCAATTAAGATGTCAACACATCTGGGATGTGACCCTTGTG
ACCACCTAATGAAGATTAACATTCTACAAATTCCTAGGACTAAAAACCTTATCCCCTTCT
ATAAAACCTACAGCAGGTCCATTTCAAGAAGGGAGATTTTGGAGGAATCTATCCATTTTA
TCTCCTTGCCTATTAAAATAAAAAATAAAAACCTACTGGTATGCAATAAAATGTCTTGCT
TCTCACCTCACCTCTGTCTGAAAGACTGGCTGTTTGCTGCAGGCAGCACAAACTCCACTT
AGATTTGCAGCAACACTTCCACATCCTGCCCTGGGGACTCTCCCCAAAGGCTTTGTGATC
AGAGAACTCCTAGTAAATCTAGATGCCTGGTAGGTAAGTTTATGGGTTTTTATGGGAGTC
CCCTTGGTGCAGTGGTGAAGACCTGTCACTGCTAACTGAAAGTTTAGTAGTTCAAATCCA
CCAGTTGCTCGTTGGAAGTCCTCGAGGGTGACCTGATGGCAACAGATTTTTATTTTTTCT
TTGTTTGTTCTAGTTTATGTGAAGATGCCTGGGCTTCAGACTGATTAGCTCCACTTTATC
TGGCTTGCTTAGCTTCTAGGAAAGACTGGTTCAAAGAAAAAATTCTGCAGTGAAAATAGT
ACCAATAAAGATAATGATGACAATCACCATGGTAGCGTTAACTACTCTAATGGGCCTGAG
CTCTCAAGACACTTGTGGCGGTACGTCTCCTCCCAAGAGGTTTCATATACAACTTTCCTC
GGAGACTAAGATCCATTGTAGAAATCGGTGATGATGGGAGAAGTAAGTAAACTTATCCTT
AGATTCTCTCTTTGTAAAGACTTTACCATCGTTATTGCTATTACCTACATTCTGATCAGG
ACTGTTGCCTGCACAACCCCTCTCCTCCCCTCATTTCCAACTGGAAGATAATTTTTGTTT
CTAAGATAGAAAGCTCTACTCATTTCCTTGGACTTATCTGTCTCCAGGCCAATATTATTG
GTTTTCTGCTCAAGGACGGTCACTGGAGGGCACCAATTATTATCCCACTCCCATAGCCTT
CCAGTCAACTCTGACTTATAGCGACTCTATAGGACAGAGTAGAATCGCTCCCATAGAGTT
TCCAAGGAGTGCCTGGTGGATTCATACTGTGTACCTCTTAGTTAGCAGCTGTAATGCTTA
ACCACTGTACCGCCAAGTTTTCCATCAGGAGCACAGAGCCTGGATTTTTCAGAGCAGAGG
TGGATTGAGACCTCTTCCAGATAGTCAAGAATAATGTACTTAAGCTGGAGATTAAAATTC
TCCTGCTTCACTACTTTAGGACATTGAATGGGGAATGTTGTTCTTTGTGGAGCATCCAGT
TCTGTACATGAATTTGAGATCACTGGTTCAAGCTGAACCAGTACCACTTTTTGCACCTTA
ATTCTGCTGGTAAGAGATTTAGAACTCTTCCAGAAACTGTTCAGTCTCTGGAGTTTCTCA
AGACCTTTAGAGATTTTAAAGAGACTAAAAAATGAGATACAGATTTCAATACCACTGGTA
GCTGGGTTTTTTTTGCTAGGCAGGCTGGACCTGAGTGTTTACAGGAGTAATGGGTNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGTCAGCAGCTGAAATACATCAGGCTCTCTATGGAAACTCATGTGG
CAGTTCTACTCTGTCTTACAGGGTCACTATGTGTAAGAATCAACTCGATGGCAATGGGTT
TACTGAGCTTTCTGTAACCCCCTTATTGCCTCTACAACTGCCATAATGCCCAGTAAAAGA
ATTATGGAAGAGCCACATCCAGTGGGCTATGCCAGTCAGATTAAAAAAAAAAAAAAAAAA
ATCCTTTTTCTGGTCTGTATTTTAAGTTCAAGAAGACATAACATCAAATTATGTTCAGTT
TCTCATGTGTGTCTACTATGTATGAATTTTAGGATGTTTATAATCACTTAGCTAGCTCTG
CTGTGCCTGCCTGAGTTTGTCAATATTCACGATGCTATAAAAAGATCAAGTCAGGGATCA
CATTTTTATTTAGATGCATAGCATGATGAAACCCATTGCCATTGGGTCGATCCTGATTCA
CAGTGACCCTATAGGACAGAGCGGAACTGCCCCATAGTTTCCAAGGAGCGCCTGGTGGAT
CTGAATGCTGACCTTCTGGTTAGCAGCTGCAGCGCTTAACCACTATGCCACCAGGGTTTC
CGCAGCAGGCTTATAACCGTTACATTGTTTTGTATTTTATGCTAATATTTAAGTTTTCTG
CACTTTGTATGTATGAAATATATTTTAAAGCATAAGTACTTAGGGTCAAAATAATTTGTG
GAAAGAAAAAGAAACAGCTACTTTATCTCCCCTCCCTCACCTAATTGTCTCTTTTCTTAA
TTTCTACCAATACTTTCTAAAAATCAACCTCCATGTAAACAAGCTCCATTTTAATTATAA
AACGATGTGGGACAGATAGTCATTTCCAGCTGTTCCTTTGATTATCTACTAAAGAGTGGT
TCTTGGTGTGATTTTCTTGTTTGGATTTTAACAGAGAGAATGAATTAATTTTATAAGTAG
AAGTTGTATGTATTTGTTGTTGAGAGTGAGAAGATTCTTTGAGAATCAAGAATTGCTCTC
ATGTAGTGGTCCCTCAGGAGGCCTGAATGGGAGGGTACAGAAGGGAGCTGATTCCAGCAG
CTCTGTGCTTACTGTCACAGCAGTGCTGTGAGCATCCAGGCCCAGTCATTGATGCTGCCT
ACCGCCTTTGAAAGGGCCCAGGAGGGGTCTAGAGAGCTTTGGAAAACAAGCAAGCAAGCA
AACAAAAACCACTGAAGGACTCAGTTAGGTGGTCAGGGATTAGGGACAAAGTGAGAAAGG
AAGGTGTATGAATCCAGGCATAATGTGGGATTAGAAAGACACCACAGAGAGCCCAGTTGC
TGCAGAATTTTATTTTATTTTTTCATTTTTTATTTGAGACAGTGATAAGAATGAGTTCAA
AGCTGGCAAGACGCAGGGTGAGAGGAGACAGCCCATCATCCAGAGTGAAGGCACATCCTT
GCCCAGGTGCCGTGACCTGAATGCACAAAGGGACAGGCACCAGAGAAGCTTCTGGTGGAG
TCCGACCCAGAGGGGCTTTGAGACCCACCATCATTGATATGTCCCTCCACTCACGTGAGG
TGAGGTTCCTACTCTCACCCTACTTTCAAGAGGTCCTAGGGGACAACTACAGGGTGTCAG
GGGTATGATGGAGGACTGTGTAGGGAAAAGAGGAGTGTCACGATGCATGCCTAATTTCTA
GGGGACAAGAGGCTATAAACGGGACCTAGACAGTCTTGTCACCAGTTTCTGCTTTCTTTA
AATCTAGATGATGAAAAGTGTCAGAACTTCGGATATCACTCTTTTAGGAGCGTGGGATAA
TCTGAACTATCTATTTTAAAGGATAATTTTCCTTTGGAATGGACTGGAAGAAAAATCGAT
ACTTTGGGAAGACAGAATTGGGGAGACAGGTTTTCCTTCCCTTAAAACACACACATACCC
GGAGGCACTTGGGTAGTACAGGATGGTTTAGTTATATGTAGGCTGAGTTGGAAGAAACAT
GGAGTAAAGATGTGTTCTTTGTTAAACAGGTCCTTCTGGTGGGAGGCAAGGTTGCTACTT
TCGCCACTCTCTGGCTCTTCCTACTTGGTTTCAAACTGCTTCAGGTACTCAAGGATGTCT
GCCTTGACTGTGCTGATTGGAGCTTTATGATACCAACGCATGACAGGGACTCCATCAGGT
CCCACCAGAAACTTCTCAAAGTTCCAACGGATGTCATGGACCTTCATGGGCTCCCAAAAG
AGTTGAGTTGGTGAGCCCAAAATCTCAGAGAGGGGAGGACAGGAGTTCTGGAGCAGAGAT
ATGAAAAATAAAAAGATAAGTTTATTTCTCCTTCTGTCAGTTCCCTCTTGCCAGATAGTC
TACTCACTGTAACACATCTTAATATATTAATTACCCTACATGCTCCCAGGCAATCACACA
CATTTCAATGAATCATCACCAACACACCAACCACAACTCAAGCAACTAAGAGTCAGAGAC
CATGGTGCTAAACAGATAACATTCCTCCTTTTTCTGTTTCTCCCTATTTCTGTGACTACA
TCATGATGCTTCAGCAAAAGAATAGACAATTTGTTTAGACTTAGTTTCCTTAGCTGAAAA
ATAATGGCTTGGATTAGGGTAGTTGTTCCTAGAGCCTGGGACTTCATAGGACAGTAAAAA
GTTGGGGAAATATATATATTTTTTGAAGTTAAGGTAAATGAACCACAGTCATCATGACAA
TAAAAACTTTTAAATAAAATTAAAATGTAAAAATGAAAGGATTTTAAAACACTAGGCTTA
AACCAAAACCCATGATTTTAACTCATGGTGACCCTATGGCACAAGACAGAACTGTTCCAG
AGAGTTTGCCAGGAGTGCCTGGTGAATTTGAACCCCAGAACGGTTAGCAGACATTAGGAC
TTAACCACTTCACTACCAGGATTTCCAAATGTTAGGTCGAACCATATAAAATTTCTGTCT
CACCATTTTGAATGACAAAATTGGCAATTTCATATGATTTAACCTAATTTTAACTTCATA
TCAGAATAAGTGACGGTCTTTTATGTTCAATTAAGTCAAGCTTTGTGGGAAAACTCCCAA
CACTTTCCTTTTTTCTCATTTTGGTGTGAATGAGTGAAAATTTCAACAAGCTCCAGCCTT
ACTCCATTGGCCAACATTTGGAAATCAGTAGACTAAGAGATCCACAGGGACCCTTCCATC
CTGGTTTTGCAGTTTTGGTATTTTGTGACTCAAAAGGCACTACACTGCAGTTAACACTAC
CGTTTCGGTTTGTCTGCCAGCTAGGTATGAGCTCCTATTAATATATGTTAACTCATTGCA
TAACATCGTTCTTTGTATATAGTAAGGATTCACTAAATAATTGTTGAATAAATAAATTAC
TACTATTCAGCAGAGGGGGTTAGACCACGTAACAGTGGACATACTCTGGTAAAAAAAAAG
TTTACGATACAGACATCATCTGTTTTCCCTGCTTCAAGTCATAGCTCCGCAACAGTTGTT
GCCGTGATCCCTGAACTTACTTGAGCGTCTCCTTCCAAGGAGTCCCCCCACAATCCTAGA
CATGAGCCCCACAGCTTTAAGCGCATCTCTGTCTGAACAATCCACACTACAATGATATTC
ACTCACCTTCAGGAAAGTATACACCTTCTGTTCTTTTTCGCCATTCACATCCCCTTTTTC
AAAGAGCTGGAAATTGGGGACAAAGCCACCACCTGGGCGCACATACCTGCAATGAACCCA
AGTGTTCTCAGGAGGATCCAAATTAGGACAAGGATGTATACTAATGTCTACCACAACTTT
CCTTGAATACTCTGGGCATCAGTTCTACCCTGGCCCCTAGGGTCGCCATGAGTCGGCTCC
GACTCCACGGCACTTGGCTGGCGACCACAACTTTGCCAAAAAAAAAAAGGAAATGAGATG
AAAAGGGAGAGAGGTGGTAGATAGGGAAGATGAGGAAAGAGAGGTCTCTTGGTATCAGAA
CTTCGTGTGATAGGCTTATTGGAGCCAACAGAGAATTCCAAGAATATTAGGTCTTATTTG
AGCATAAATACAGGAAGGGGACATGAACTCCTTCTCATCCCTCTTGGTCTCCTCATGATT
CACTTCCACTTCATTCTCCGTATTCCCTCCTTTCCCCTATCCTCCTAACCCTGCATCCAG
AATCTCTGTGCTTCTTTTGCATTATATGTTTCCCTGGTCTCACCATCAAAGAACCCAAAG
TTAGTGAGAATAGCATGTCCCAAAAGCCAGATGANNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAATCATTTT
TAGGTCATATTTATTAGTTCCTTTGATGAAAACCCAACTGGTAACATTCAAACTCAACTC
TACTTGCTGGTGTTTGCCTTAAGACCATTTTTTTAGATAGAGAGTGACTTTCTATTTTTG
TATATTTCTTCAGTTGCTGTGCACACTCACCTCCCTCTTATCTTTAGCAATCAGGAATGC
TTCCCTCTTATGTTTAGAAGAAATGGAGTACTTGAACGGAGCAAACAGCTAACATGTTTG
GTTGCTAACCAAAAAGTTGAAAGTTTGAGTCTACCCAGAGGCACTTCAGAAGAAAAGCCT
GGTAATCTACTTCTGAGAAATCAGCTATCGAAAATCTTATGAAACACAGTCCTACCCTCA
CACATGTGAGGTCAGATTGGTTTTGATGGAACTGGTGGGTTGGCTGATATAGTAGAAATA
CTTCACAGACCTTGATTCTGGTCCTTGGCAAGTTACTTTAACTGTCTCAATTTCCTCATC
TCGACTGTAATTTGAAAGAGATACACTTTAAAAGCCTCTTTAACTAGGTAATTCAATAAA
TCATACCACAGCAACATAATGGAAAATTCTATAGCTTAAAAGTGAATGAGGAAACTCATC
CTGTGTTGATACAGAATAATCTCCAAAACATTTTATTTTGCTGTGTGAAAAAGCAAGGTG
AAAACGGTCATCTAAAGGAAAAAGAACATCAAAGATTTCATTGTAAACATTTTTGTTATC
TTTTGAATTTTGTAAATACATTACCTATTCAACACATAACATGTTTAAATTAATCCTAAA
GCAGAAAATAAAGTACTTGTCATATCAAGAACAACATCTGTCTCTAGTACAATCCATATA
GAACTCTAGTTCACCTTTTCTGGATAACCAAGAAACTCAAATTACTCTTGATGAGTGCAC
AAAGAAAGAAAAATTCGTATCAGCCACCGTAGAGGCTGGGCTGAGTTTGGAAGGATAGAG
CAGTCTCCCCTATCACCAGTCACCTTATTACCCTTTGTTCTACTGCAGCCCAGATGGGCA
ACCACATTCCCTTCTTTGTCACTTGGAGACACCTTGTCGAACTCAGTATCTTTTTCCAAA
AGATAGTCTTCTCTCCTTGTTGTTAACAGGAGTCCACAGTGAGAAAAATAAAAGCAGCCC
CTTGACAGCAGGAGCTAGCTGGCAATCATAGCTAANNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNATGTGCAGATGCGGTTTAGTAAGGTATTCATTCATAGAATT
GACTCCATTTCCTGACAGCATCCAGGAAAACTTTAATTCCTTGAACTCTCACCCAAAATC
CTTAACATAAGCCCAGATCCTATAGTAAGTCCTTTCTAATGCTTTACTGAGAAGTCCTAG
GGTTTCTTACAGTATATAGGGGGCACTGAGCAACAAACTCAACTTGTTCAACTACTGATG
TGTTCCTGGTCGTCTTTGGTTCAGTGTTTGAGATGGTTTTCGTTCTCAGGTGTAGACATA
ATTCTCCTGGCAGTCTAAGGAGCAGAACAGTGGTAGGACTTAGGGGAATGGAATCCTATC
TCTCCTCTGCCCCCAAAAGAATACATTAGCAGAAATTTCTTGAATTAGAATATGGCTGTG
TGAAACATGAGTTCTTACCAGGATACTGAGCTGTCAAGCCTCAATAGGTAGCCACGTTGA
CAAAGAGGACGTGCTTGCCCGCATACTTCTTGAACTGGATATATTCCTCGCCGTTGAGGG
TGAGGGCTCCATACTCGTAGACATTGCCTGTTACCCCTTTGTAGCAATCCGCCTGAAATA
TAATAAAACTAATCATAATGATGTAATGATAAAATAAGCAACAGTGTCCAACATCTGTAA
ACTCTTTCAAAACAAAGACCTTTCATATAATAAGTTAGAACGCTTAAGAATTTAAGAGGC
CTCTTCAAGTAGTGTTTATAATCAGGTTCAAGCCACCACTAGAAATTACGTCTTCTGACT
TTTTCTCTTCTTTCTTAGTGGAGGAGCAAGTGCTTCATGATGCTCTTCCCACTTCTGGAA
AATTAATACAACTCACCTGGTGTTAAATCCCCCCCCATATCCTTAATTCCACCTCCAGTC
ACCCATCTCTTCTCAAATATTCTTAATAGACTTTTGTAAAGTTTATCAAAATAGGAGTAA
GCTCTTCATTGATTTCTCATTTATATGCTCTTCTATTGTAATTCCTTCCCTCTGAGAGTC
AGGCCCGTAACATGCTCCTACTCTTCATCTCACTGAATAGTCTTTCTGGGGTTTTGTCAC
TGATGTACTCACGGTTAACAGTCCCCCTCTCCACATCCTTACATTGTAGTTTGGAAGGAT
AGAGCAGTCTCCTCTACTACCAGTCACCTTATCACCCTTTGTTCTACTGGAGCCTAGATG
GACAACATTCCCTTCTTTGTCGCTTGGAGACACCTTGTCGAACCCAGTGTCTTTTTCCAA
AAGATAGTCTTCTCTCCTGTTGTGAGGAGAGACTCCTCACAAGTTGGAAATTATATATTA
TAAAGCATAGGGAGGAAACTTCCTGTGGACAGGCAGATCGAGTCTAGAACTGAAGACCAA
GCTCTTGTTATAAGAAGGGTTGGATTTAAATCAGACTTCCTGGAGATGTTGAAAGAAGTC
TTAGAATTTTAGGGAAATATAAATTGGGCCACTAGGGATCTTAGTCCATCAAGGTCTGCC
TCATGCAGTGAAGGAATCTCCCATAGGTGAGCTTCTATGGTGAAAGTGGGGTAAGGAGAT
CTTTTATTATCTATGAAGTCTGTAAATACTAACATCAGTACACTAGACAATCGCTGTTCC
TTCACTGTCCTTGGCAAGAAGGAGGTTCCCCCTATGGAAAGTCCCTTTCCAGAGTGCTCA
TCATGCAGTCATGCACACTTACACACACACACTTTAGTCTGCATATTTGAGAGCATCAGA
CTATGGAACTCCCATTGAAGGGGTTGCCATCTATGTGCCTGCTTTCTCCTTGCCGACTTT
GCTGTGTGCTTAACAGTTCTTGCATTTGTCTTTCCTGTTACTGCAAAACTAAGTAGAATG
CAGGGTCCCGGGGAAATTGTAGACTTAAAAAGAGTTCAATCCTTCCTTTCTAGCTCTTGT
ATATTCTTCAATTTTGTTTCAGTTTGTTTAGGTCTGTTTGAAGAGGTCAGGATGTCCTGA
CCTCTTTTCGTAAAATTCTACATCCAGAACTTCCACCTAATAAGGCAGCAGTGACTGACA
CAGATCTAGAAATTCACTTTGGAGATGGTTTTTGTTTTTTTTTTATTTCGAAGACAGGGA
GTAATCTTACTACAGGTACCAGCTGTTGATTTTACCTGCATTATCTTAATCTTTACACTC
ACTAATCACAATGAAACTCAAACCCACTGCCGTCAAGCTGATTCTGACTCATGGACACAG
TGGAACTGTCCCATAGAGTTTCCAAGAAGCACCTGGTGGATGCAAACTACCCATTTTTTG
GTTAGCAGCCATAGCACTTAACCACTAGGCCACCAGGGTTTCTAACTCAATAACAGAGGT
ACTCCAAAGTATGTTCTGAGGAGTAGACTTGGGAGCAGTGTTAGAAATGCATTCTTGGGC
CCCACTCAGAGATTCTGGATCAGAACCACGCGGGTGGAGTCTAGAGATCTGTCCCATAGC
AAGCTCTCTGCAGGATTCGTATACATGCTGAAGTCTGAGGCACTCTATTACATGATGGAT
GGGTGTGGTTCTCCATCTTTTATAAATGGGAGAAAGGAACCGACATAAGATAAATTTTGA
ATGAATTTGTCTGGTTTTAAAATTAGCACTTTTTGTTGCCTCAGATCATCTCCTTGGGCC
TTAACTCCCAACTCCACCCCGTAACCTCCCACACAGACACACATCTTTTACCCCCTATAC
TGACATCCAGTATAGGGGGTTTCTGAAGAGCGCCCGCTAATTTGGGGCAGAACGCAGACC
TAAGAGCATATTCTCTTCGGATGGGAGCCTCACCTCCTCACCATAATCACCTCTTCTATG
ATTACAACCATCACTGCCGTGCTCAGAGCACATTCTTCTAGCAACATCTCTTCTCCCTTC
TCCTGGTTTCTGACTGAGCAGCCTTTCTCAGAGATCACGTCAAACTCCTTCTCAGCCAGT
TTGCTTTCACACCCCTCCCCATTTCCCTTAGACGCTTGGGGTCGCCCCTTAGACAAGTTC
GAGACCAGCTTAGAGGGCACTGGCTCTAGGCCATGAAGCGGCCCCCAGGGGGAAACGGGA
AGCGGGAATGCACGCTTTGTGCACGGTCCACGCGTCTCAACTAATCNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTATAGGTCGGTTCTACTCTATCCT
ACAGGGTCCCTATGAGTTGGCCAATTAGAATGGAAGACAATGAGTTTTTTATTTTTGCCA
TTTCTTTTTTCTCTTAGTCTGGGGACAACACTGCCACAAAATAATGGACATAGGGATTGA
AGTTTAGAGTCAGGATCTTAGGTTTTCATCCCAGCTCTCATGGTGAGTCACTGTGCCTAC
TTGGCAAACCAATTCTCTCTGAGCCTCAGTTCCCTCTGTTGATGGACACATTTGGACTAC
TCACTGGGTAATTACTAGGGTGTCTTTCAGCTCTAATAAAATATGTTTTTATGGTGTCTT
ATGGGTCCACCAGAGGCAGGTTAGGTAAGAATACATTTTTTACCCTTGCTACTCAGTGAA
CCACCAAAAAGAGCATCATTTGGAAGATTCTTGGAAATCTCAGGACCCAATCCTAAGCCC
TTAGACCGCAATGCACTCCTTAAACAAGCTCATCACGTGATTTATATGCACACTAAAATA
CAAGAAACACTGCTCCCAAACAAACAAAACCTATTGTTGTTTAGTGGATGTCAACTCACA
GCGACCCTACAGTATAGAATAGAACTGCCCCATAGGGTTTCCAAGGCTGTAATCTTTATG
AAAGCAGACTGCCACATCTGTCTTCTGACAAGCAGATGATGGGTTCAAACCTCTGAGGTT
TCAGCTAGTAAGGAGGTGCTTAACCACTGCTCCACCAGGGCTTCTGTTAGCATTCCCCTA
AATGACTGTTTTTCTTTTGCTTCACGTCTTTAAACTCTTCATCTCTCAGTAAATGAAACA
CTGTACCAAAAGCAAAAAAACTCCCCACTGTCTTCCAGTTGATTCTGAATCATAATGATG
CTATGGACAGAGTAGAACTGCTCCAGAGAGTTTCCAAGGAGCACCTGGTGGACTTGAACT
GTCAGCCTTCTTGGTTAGTAGCCATAGCACTTAACCACTATACCACCAGAGTTTCACCAT
ATTGAAGCAACCAAAGCCACCATTATCAAGTCGATTCTGAGTAGTAACCCTATGGACAGA
GTAGAACTGCCCCATAGAGTTTCCAAAGAGCACCTGGTGGATTTGAACTGCTGACTTTTT
GGTTAGCAGACATAGCACTTAACCACTACAGTATTACACAGTACATTTAATTATCAACAT
TAGCTGCGGGGGGCTTGAGTATTGCAGACAATTTGCTAAGTAGTCTGTCCCCTGGAGAGG
GGCTCAACATGCAAGAGTAGCAGGGATGGGAAAACACAGTGACAGTGGAAAGTTTTCACA
GAGAAAGCTGTAAACTGTTTTTCAGTGAACTAACTGCCCTGGGCTTAAATTTCATTCGTT
GTAAATGGTAACTATTGTCTCTGTCTCACATACTCTATAAACCCACTATAAGATAACCAT
TGAGGTAGTGGGAAGTATTGGGACTGGCTAAAAGGCAAGGAATTTGTTTCCCTGGCTACC
TCCTTTCCCATTTTTCTCCCATCTGGCTTTGCCAGCTCAGCATTACAGAACTCCTTGTTA
ATTGTAGTGATAGATTCTTTCCCTCTGCTTGCCCCGCCTCTTCCAGGTTCACAAAAGGGC
TGTTCCTCCTCCTGGGACTGAAGTCTGGATCAGGTTCAGTTTTTGTAAACTCTTATGCAA
GAAAGAAGCTTTTCATTATTTTGGATTTCTGAGTTTTTTTCAGCGGCTTCTAATCTACAG
CCTGATCAGTAACACTTGATCCAGTCATGCAAGGCCCTAAGGCTTTTTGGCAGTCAAGCC
AAAGTCTTCCCTCTTTGGACACCAAAAAAAGAAAACAAAACCCAGTGACACTGAGTCAAT
TCTGATTCATAGTGACCCTATAGAACAGAGTAGAACTGCCCCCATAGAGTTTCCACAGAG
CAGGTGGTGGATTTGAACCACCAACCTTCTGGTTAGCAGGCATAGCACTTAACCACTAGG
CCACCAGGGTTTCCTCTTTGGGAACCAACCTGCACATATTCCCAAACTATTCTGCCCTCC
ATTCCTTCTCAGTTAAACAAACAAACAAAAAAAGGCTGAACTTTAGACTATAAGGCTATA
GACATGATTGAATTAATGATTCCGCGTGCCACCAACTGGATTCTGAAAAGCTGTTGATTC
TGTACCTCA
Chart Advanced