SelenoDB
Release 2.0
Chart Advanced
Sequence Report for SEQ00002083_2.0
Identity
SequenceIodothyronine deiodinase 3 (DIO3)
SpeciesPongo abelii (Orangutan)
DescriptionGenome -assembly-
Sequence IDSEQ00002083
Sequence release2.0
External IDNone
Gene SPG00002087_2.0
Annotation
Prediction method(s) None
OrientationForward
Toolbox
Sequence
>SEQ00002083_2.0 # Sequence # Iodothyronine deiodinase 3 (DIO3) # Orangutan 
AGGCAGGCGAAGGCGGTACTGGGTGGAAGTGGCAGAGCATGAGGCGAGGTAGGACCAGCA
CTGGGGCACCTTCGTCCTCAAGTGGGGCTCTCAGCAGCCGCAGAACAGCAGGCAGGGCCA
GAATAGCATCTCCTAGAACTTCCTAGAACCTTCTGGCGTGCAAAATGACCCATGGGGAAG
GCACTGGAAAGTCACCACCCAACCCACCCCTGATGCAGATGAGACCTGAGGAAGGGGCCA
GAGATGCGCAGGGTCACACAGCAAGTAGCCAGGGCACTGCCTCCTAGGCCTTCTCCTCTT
CTTGGCCGGGAGCCCCAGACCTTCTCCAACCCCCAAATGCTGCCAAACACTCCTGCTAGA
TCCAGGCCCTGGGGCCCTGACAAGCTGTCCTGGCTGGGATCCCAGCCTGCCCAGTCACCC
CAGAGTCCTGCCACCTCCCCCATGCCTGCCTCAAACTCCCAGAGGGATGGAGATCTGCCA
TGTTGAGGACACCTCTCAGACCAGAGCTCTGGGTCCCTCAGCCATCTCCCACCCCATCCC
CTGCAGGGTGTCCCTATGCTCAACCTAGCCAAGTGTGTGGATAGAAGAATTCATTCTTAA
AGTAAATGAGAAGTGTAAACACCTCTGTGGGAGGGCCCAGGTACCCGTGGGAAGACCTGT
TTAGCCCAGAAAGGGAAACAGATTGGCCCAGTGACCAGGTGACGGGTGCATTCACCAGAC
ACCACGCCCCAAACGGACTTCCCAGGAAGTGTCTGCTCACAGCGGCAGGTCCTGACCCAC
CGTGCTCAGCCCTGGCTGCTGACATGCCACCCCAGCTCACTGCTGCAGGTACGCCAAAGG
ACAGAGTGAAATACCCTGAGTTTCTCCCCAAACAAGGAGTTTTCAGTAAGTACACACCGC
ACTCATTTACTCCATTCACAAAGGTTTATTGGGTCCCTGCCCAGTGCTGGTTCGGGTTAG
TCACTGCAGAGGATCCATCTGGGCCAGCCTGGGAGGGACAGGTCTGGAGTACGAGGCAGA
CATGAAACCGGGGGTGACACCTGGGGCTGTGGAGGCTGCCATGCCAAGGACAGCTCTGGG
AGGACCGCTGAAGAGGATGACTAGCTGGCAGGCAGTGGGGTTCGGCCATCTCCCGGGAGC
TGGGAGGGCCCAGGTGGAGGTGAGGGCAGCAGTGGAGGAGGAGGAGGAATGGGGGTCTCC
AGGTAGAAGAAGGGAGCAGGGAATAGCATGAGTGGAAGCCCAGAGGAAGGAAAGTACCTG
GAGGGTCTCTGTGCTTCAAGAGGCCAGTGGAGGGGACAGAGACAAAGGGCCAGTGGTGAA
GCAGGGCTGACACCCAGGCAGCAAGGACACTGAGGCACACACCTGCCGTTCACCAGCACT
CTCCTCCAGGTGTGCACCAGCTCCTGCGTGAAGCCTCAGGAGGTCCTCCTACAGGGGAAC
ACAGGGCCACCAGAACCCACCCCACCCCATCCCAGAGGGAAGTCTCAGTGACAGCCTCTC
TGGGCCTTGGGAGCTGCTGTACTGGAATGGAGAAAGAGGCTGTACCCATTGCAAACCTGC
CTACCACGCCCTGCACTGGGGCAGTGAGGTTGGGGGGGGTCTGCACCAGGGTTCACCAAA
CCCTCCCTTTCAAGGGAAGACTGCCCCAGGAGGATGGGCTTGGGATCAGAAGGCCATCCA
AAGGCCAGCCCTCCCCTGGCTCTGCCAGGGCCCTGCTGCCTGTCCCCTCCCCGCCTCTCT
CCAAGTTGTTCCTGGACACCAAATGGACCCCATCCAACTTGTCCCTCCTTTTCTTTTCCC
TGCCCGCCCCCTGCTGGAGTTGTAAGAGGGCAGGCAGAAAGGGAGGTGGGGGAGGCCCAG
CCAGGCTGGGGGGGCAGGAGAAGCAGCCCCAGTTCTAACTCTGCTTCCCCCACAGCAGAG
CCTGCCAGGCCCCCGAGGGCCGGGACCTCTGGGTGATGCCTGCGGCTCCCCTAAGTCACA
GGTGGAGCTGGGCCTTTGGCCAGTACTCTCCCTCCTGACCACTGGGATGGGACAAGACAG
TAGGGGCAACAGGTAGGAAGGGCCAGGTCTAAGGTGAGCTGGGGGTGCAGCCCTAGAGAG
AAGTAGGAAGGAGAGACAGGGGTTGCTCCGGAGGAGAGAGAGTTGCTCCGGAGGCAGAGG
GAAAAGACAACTGGAGTGGCAGTCACTGAGCCAGGTTCTGTGTTCCAAAGGCCAGCATTG
CCTGGACCTTGGGTCTGTCCTCACCTGCACAAGAGGCTGCAGGATCCAAATGGGCCTTCC
AGCCTTGTCCAATATTATGGAGTCCCGAGGTATGGAGTGTATTCTGTGGGCCCAAGGAAC
AGCAACAGATCCCCAGAACAGATGACAGCCCTAAAGAAGAGCTGCTTTCCTGAGCATCTC
TGGGGCTAGAAAGAGTGTGGATCAGGTGCTTCCTATTGGGCTGGGTCTGCAGAGGGGACA
AGAGGGGCCAGTCTTACAGCCACCCAGACCATACTTTCCACACACATGCACATGCGTGCA
CACACTTGCACACACACACACACTTACACACACACTTACACACACGTGCACACATGCACA
CTTGCATGCACAACTGCACGCACATACACACTTGCACACACAATCGTGTGTGCCCACTTG
CACACATGCATGCACACACTTGCACACATTCATGCACACATACACACGCTTGCACACACA
CTTGCACACACACGCGTGCACATGCCACCAGATCTCAGGCAGCACAGAAAGGCTTCTCCC
AGCCTTAGGTGGCTTATGCATTTTCTGAAACTGGGAAAAGGGCTTGGGGAACCATCCCAT
GTGCCTTCACCAAATGCTGTGTGGGTGGCGGCAGGACACAAGCCCTACACTGACACCTCC
CAAAAATCAGGGAATCAGAGCTTGAGAGATTGTCCAGTAAAAGTTGGAACCGTCAACACC
CCTTGACTCTGCCCAGGAGGAGCAACCTCAGAAGTCCCCCCACACCTCCTCTCAGAGACC
TGCCGAGTAGGAGGCTTCTCTCTTTACTCTCCTCCCCGCAAAAAAGAGGCCAGAAAAGGG
GACGATTGGCTAACTCAGAGGTGCCCTGATGGAGGAAAGCAGACAAGGGGGCTTCCAAGG
AGAATTCGCTAGCCCACCTGAAAGACCCCTACCCAGAGTGGCGAGGGGCAGCTTAGGAGC
ACTGACGCAAGGGGGAGAGACCAGGCTGGCTTCCCTCTAGGTAGTAAGTTCCCGGGGTGT
GCGCCCCTGCCCCAGACAGCAGAGAAATCGCCTGACTGGGAGATGGAGAAGAGGGGCCAC
CTTCTCATGCCACCCGGCCGCCAATCCTCCAGGCACACTTGGGCGCTTGACCTGCTGAAG
CCTGGAGCCACAGGTCCAGTGGGGAGCTCACGGGACAGAGGGCCCTACAAGAGCCACGAA
AACCGGAGGGGGGGACCTCCGCCCAAGGCAGGCGTCTCTGCGCGCCCGCTGGGGCCCTGG
TCCTGCGGTTGGCTTCTCCCGACACGTTCCTTCGCTGCCGAAAGCGATTCGCCCGCGCTC
TATCGAGCCCAGCCAGCTCCTACCTCGGCCCGGGCGGCGAGCGCTGTCTCCGTCCCGAGA
AGAAGTTTCGCGGCTGGTCCCGGGGCGGCAGGCGCACGGGACGCTGGCGGCGGCGGCTTC
GGACTTGGGCTCAGACCCCGCCGCTCCAGACAAGTCCCCGCGACTGCGACAGTGTCCCGG
GCAGTTCAGCTCCCCAGACGGGAGACAGACCCTCGCGACCTGGTTCAGGCCTTGCCCTGG
GGGACACTGCGGTCCAAGGCGAAAGGAGACTTGCTCCCGGCCTCTGGGTCCCTAGGTCAA
GGCACCTCCCCGCCCCGCCGCCCCTGAGCCCAAGTCGCCAACCCCGCGCCGCGCGCAGCG
AGGGATCAGAAGGTCTCGGACGCCGCGGCAGGGCCGGCCAGGGCCCCACGAGTTAGGGAG
TTGCCCCGCACCCCTAAACGCTCAGCACCCATTTACGGTTGAAAGTACGCACTTGACGCG
TCCGGGCGCCTCCGCGGTGAGTCGCGCCGCCGCTCTCGGGGTCCGCGAAGGTGGCTCAGT
TCGGGCGCTCCAGTCTCGACGTTCCCGGGGTAGAGAGCAACGTCCGGGGACGAACGGGAC
GGGTGCGCCCAGCGGCCGGGGCTGCGCTGGGCGAGGCAAGCGGCGAGAGGGGAGCGCTCC
GGCGTTCAGGCAACAGCTACCCCTAGTGGGAGAGCCGCCCGGGGCCGGCGCCGCCCCGCG
CCCGCTGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNCCCGGGCCCGCCCCCACCGGCCCCAGGCCCGGCCGCTCCGCCCTC
CGCCCGCCTGCGCCCGCCCTCAGCCCACGATTTCTAGGGCATTGGCGGCGCTGCTGGGTG
ATCCCTCCGGGCTCAAGTTGCAAGGGGGCGGGCCGGGCTGGAGGTGGAGTCTCCCGCCAA
TTGAAGCCTCGGCTATAAATTAAACTCCCTGTACTGCCGAAGCCCAGATGCCTCGCCGGG
CCGCATCGCGGTTGGTGGTCGGAGAGGGCGAGGGGTCCCAGGGGGCTTCGGGGCCTGCAG
CCACCATGCTCCGCTCCCTGCTGCTTCACTCCTTGAGGCTCTGCGCCCAGACCGCCTCGT
GCCTCGTGCTCTTCCCGCGCTTCCTCGGCACGGCCTTCATGCTCTGGCTTCTCGATTTCT
TGTGTATCCGCAAGCATTTCCTGGGCCGCCGCCGCCGGGGGCAGCCCGAGCCCGAAGTGG
AGCTCAACAGTGAAGGCGAGGAGGTGCCCCCCGATGACCCGCCCATCTGCGTGTCCGACG
ACAACCGCCTGTGCACCCTGGCGTCGCTCAAGGCGGTGTGGCATGGCCAGAAGTTGGATT
TCTTCAAGCAGGCGCACGAGGGCGGTCCGGCGCCCAACTCCGAGGTGGTTCTGCCCGACG
GCTTTCAGAGCCAGCACATCCTCGACTACGCGCAAGGGAACCGCCCGCTGGTTCTCAATT
TCGGCAGCTGCACCTGACCACCGTTCATGGCGCGCATGAGCGCCTTCCAGCGCCTGGTCA
CCAAGTACCAGAGCGACGTCGACTTCCTCATCATCTACATCGAGGAAGCGCACCCCTCCG
ACGGCTGGGTCACCACGGACTCCCCCTACATCATACCGCAGCACCGGAGCCTGGAGGACC
GGGTCAGCGCAGCGAGGGTACTGCAGCAAGGTGCACCCGGCTGCGCTCTGGTCCTTGACA
CCATGGCCAACTCCAGCAGCTCGGCCTATGGCGCCTACTTCGAGCGTCTCTATGTCATCC
AGAGTGGCACTATTATGTACCAGGGCGGCCGTGGCCCCGACGGCTACCAGGTCTCTGAGC
TGCGCACTTGGTTGGAACGCTATGATGAGCAACTGCACGGCGCTCGGCCCCGGAGGGTGT
AAACATCCAACGGACAACTGACTGAACTTGGTGTGCTGGGCCTTCGAGCCTTCGAAGCCC
ACGTGCAAGCGCCTCAAACCAAGTCACGCTTGGCGAGGCCCCAGTGACACTGATGTGCTG
AGCCACCATTTCAGACTGAGTCTGCGCCCTCAGCCACATGAACAATCTCCCCTACCTCCC
TGGGACTCTGCTTCTGTAACTGTCTCATTCACACCTGCCTGGCTCACTGGAAATCCTCTT
CTGAGCGCGGGATACGGCTTGCCCTTGTCCGTGTGCCCCCAGGACTTTGCCTCTACAGCA
TTTTCTTACACCCCCTCCCCAGCGTGCCCTCAGCCAAGTGCTTTGGCCCAGTGCTTCCCA
CAGCGCACAGAGACCTTGGCCAAGCCCGCGCGCCCTGAGCGCAGCTGGGTTCCAGGAGAC
TCTCAGCTCAGCTGAGCTAGTTGCCTGGCACCCACCTGTCGCGCTCGGAGAGGGGGTTCC
CTGTTGCTTTTGTGTCTGTTTCCTGTCCCTGGTAGGGGAAGTGATGTCGGGGATGGGGAG
GGGGTGGGCAGGGTAGTTTCCCCCGCTTGTTTTGGGTGCACAGGAGCCCCACTGCTGATG
ACGGACTATCTCTAACTGGTCTTGACCACGAGCTAGTTCTGAATTGCAGGGGCCTCAAAG
CAGCACCTAAACCTTGAGGGGGAGAGTGCTCTGGGTTTCCGTGAGGTAACCATCTTAAAT
GGGAGGGAAGTTGGGGTGTCTGCTTTGGGACCAGAGGAAGATAGCTTGAGAGGCATTGGC
GAGGTTCGCAGCGCCCCAGGGAGAGAGAAAAAGCTGAGACTCCTGGGGAATGATGTTGGG
GTGATGGAGTCCGGGGAAAGAGAGGTGGGGGGAGAGCCTGAGGTCCCCAAGTGAGGGGAG
TCCTAGGCAGAGCTGCTGATTGTGGGGCTGGGAGGTGGAGGGCCCCTGATTCGAAGGCCA
TTTGGTGAGTGTTTTGCTGGAAATATTTCCTGTATATAAACTTCTTTCAATCTACAATAA
TAAAGGCTTGAGGTAAACTGCTTTCTGGTTGCCTTTGGTCCCTTTATTTTCTTTTCCCTC
TGAATAGCGACAGGAATTAAACACAAATCCCTCCCTCGCGTCCCCATAGTGACCTTGGGA
AGCGGGACGGGAAGGAGCCTAGGCTGGCAGGGGCGCTGGAGGAGGATGGAGGAGGAAGAG
GGTCTGCGGCGGTGCCCAGGGCGCTCCTACAAGCGCACGCACTCACCTGGACGGGGAACT
TAGCTGCGGGAGAAGAGAGAGGTAGCGGAGCGCCGCGGGATCCTGGAAAGCGGCGGGAGA
GGCAAGAGGGTCCTCTCTTGCTCCCGCGCGCGCACACACAGACCGAACAGATGCAGCTGC
CCCTGCGGCCGCCGGTCTAACTTAACTGAGTATCCGGCGGTGTGTGGAGGGGGTGGGGTG
AGGTGGAGGGCGAGAGGGGCTTTGGACCCGGTACAGCCTCGCTCCCGACCGCTGCAGGCA
CCACTGCGCACCTGACTCCTCCCTGGCCCCCTTCCGGCACCTGCAACCTTGCCTCTTGCC
CACCCGCTCCAGGCAGCTGAGGTCCGCGGGAGGCGCGCCTTGGCAGAGGGGCGCCCTCAC
TCCAGCTGCGGCTCCTACTGCCGGGCCAGCGTGCTGCTGGGTGCGCCCCCTGCCCAGGAC
CCCCCTCCTCCTGTCCCTCCTCCGCTTCCCCAAGCTCCAGTCAAACCCCACCACCCGCTC
CGGGCTGGGAAGCAGAGGTGGGAGGCCGCTGGGATGAACAGACAGAGACCAGGGAGAGGT
GAATGGTGGATTCCAGGGCTGGGGCGGGGATTCGGGGCCTTAGGCACAGGTCCCCGCCTG
CAGTCACGGCCAGGGGCTCGCTCCTGCGCAATCCCCGCCCTCACTGTCTCGCCTGTTGCG
CCCGGAGTGAGGGCGACGTGGGGGGCGCGGGATTAGCTTGGCCCGCAGAAAAGTGTGCCA
GCGAAACCTTGAACATGACGTGAAAGGTGTGGGTCGTCAGTGAAAGTCGCTGAGGCGGGA
GTGTGCGGATCCAGGTGAGGGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCCC
AGCCCCTACGCTGTTCTTCCGTAAAACTTTTTGAAACTGACATCCTAAATTGGTGGATTT
TTTTTTCCTTTAAAAGTATCTCAATTGAAAAATAACTTTGAAGAAAAATTTGGCACCCAC
GAAATTTCTGCATCTCCTCCCCACTACCACCACCCCCTACCCACCTCCGCGAACGCTCCT
TCTCATCCCGAAACCGCCAGGAAGAAAAGGAGATCGCGGCGGGGACGCGGCCCGGCGCCT
GGGAGAGTCCTCCCTGACCTCCCCGCACGCGCGGCTGGCCGGCACTGGAGTTTGGTGGCG
CGGAGGGTGGCCTGGGACAGCGTCAGCCTCCCGACCCAGCAGAGACCGCTCCAGCCGCTC
CGCGTCCCTACCGGTGGCTTGGGGGTCCCCTTGGACGCGCCAAGCGACCTCCCCTACCCG
GAAAGCCTGCGCCCCCTGGGCCTTCTGGAGCTTCCCAGAGCCAAACTCCAAAAAGCGCTT
TCGCGCCGCAGCGCCGGGACCTGCAGCGCCAGCCACTCCCCGCACTCGCTCTGGTCGCAG
CTCCAGGGAAGTCCCACCACCCCCACTTTTTTATTTCTCTCTTCTTCCTTCCCTTCCTCC
CTTCTTCCACTTCATCTTTCCTTTTCTTTCTCTCTTACTTTCCCCTCCTTCTTCTTCTGT
TTCTTCCTTTCCTTTCTTCTTTCTCTCTTTCCCTTGAAAATGTCCCCTATGAAAGCAATG
CAAGCTCATTGCCGATACAACAGAACTCCGGGAAGGAACTAAAACCAACCCAAGGTAACT
CTTCGTGAGTGTGGAGCCCCCTCACTCCACACTTGTCTCTCTGTGTCCCTCTCCCTCACA
CTTGCAAATATATATTTTGAAAACAAGGGCAGGGTGGTGTTATCCTTTTGTAGCCTGTCA
GTAACTTCTTACTCCCAGGGCGCCCCTTCTTTCCTGCACCTTTCTTTCCATGTCCATAAA
TAAGTCTTGAATAGCCGCGCATCGCCCTCAATTGGATGATCAGCAAGGGTCCATGGGTGG
ACATCCCAGATGTTAGGGATGTTTCATTATTACAAACAAAGTCGGGGTGAGCAGCCTATG
AGCGCAGCTCTGTACCCGGTTACCCCAGCTAGTAACGTGTCAAAGTGAAGCAGCTCCGAC
GAGAAGTATGTACACGTTTAAAGAGATCTGTTTTGCCACATTTTGCTGAGCTGTCTTCAG
GAAGCCTGTTTGACTTTTATTGTTTTGTATTTTCCCATTGCTCCCTCTCTCTCCCTTTAT
TTTTAAGTGAAAAATTACAAAGACAATAGTTGAATCCATCCTCCATATTAAATTTTAAAT
ACAGAAGAACACAGAGCAGAAATGCAAAGCCTCCCTCAGAGCAGGAGATTTCAAACTATA
AATCAGGGCCCAGCAGTGGGGCATGAAATCAATTTATCAGATCAAGTCAAGCATTTGGAA
GAATGAAATAAAATAAACACGGTAAGAATAGCAGCGTACATTTCACCTAGGGTGGCTGGA
GTTTCTGCAACTTTGGCTTCAGTTATACCTATCATGTGTGAGTGAGTGTGTGTGCATATG
TGTATGTGGGATTGTATGTGTGAGCATATGTATGTGTGTGTTCCAGGTGGCTGAAATGAA
GCGTATTTCTCCTGAGGGATCAAAAATGTTTGCAAGCCACCACCTGATCATCACCATTCC
TCACTCAACCAGGATAGCCCCTGGTGACTGTTGGGTGCGTTTCTCTCCAGATTCTATTTC
ACATATTGACCGTCCGGTATGTCATATTCTCAGATGAGAACAAGCACATTCTCAAACATA
TTTTCCCTAATTGGGATCATGCCACATAGTGTTTGATGACACGCCCCCCACCCACCCACA
CACACACACACACACACACACACACACACACACACACACACACACACTCTGTTCTCATGC
CGTTCCTACCTTGGCCCCCTCACCTGTGGATGCATCTAATCTGAGCAGGTCTGCACCTGT
AGGCTGATTTGTGCCTGGCACCATCCGGATGGCTGAGGCCCCTTGAGGAATGCTGGAATC
AGTGGGGAACAGGGTGAGGAGACAGCCATTGCTGGTGTCGCAGTCACCATCGCCCTCACA
ATTAGTATCTTTTCAAGGTCCAGTGTGGCCTTAGCAGATGGTTTAGCCTTAAGCAAGGAG
AGAGAGGAGGGGCATTAAAAGAGTTCATAGAAAGGGTCTTATTTGCCCCTTGAAGGCACA
GGTGGCTCCCCAGGATGGCATAGATAGAAGGAAGGGCATCCCTGGCAGAGGGCACTGCCA
GTGCAAAGCCCTCGAGGCCTGAAGGTTTATGTCATATTCAGAAAGCAAGGAGTCTTCAGT
GTGGCTACAAAGCAGGAGGGTGACAAGGCCAATGAAGAGGGGGAGAGGCAGAAAGGGGCC
CAGCCAGTTTGGGAAGAGCTTTAGGCACCAGCTTGCAACTCTGCTGAGCCTTTGG
Chart Advanced