SelenoDB
Release 2.0
Chart Advanced
Sequence Report for SEQ00002053_2.0
Identity
SequenceIodothyronine deiodinase 3 (DIO3)
SpeciesPetromyzon marinus (Lamprey)
DescriptionGenome -assembly-
Sequence IDSEQ00002053
Sequence release2.0
External IDNone
Gene SPG00002057_2.0
Annotation
Prediction method(s) None
OrientationReverse
Toolbox Forward Reverse  
Sequence
>SEQ00002053_2.0 # Sequence # Iodothyronine deiodinase 3 (DIO3) # Lamprey 
GGTATAATTGGTGTTAACTGTGCTTAGGTATAATTTATATAATTGTGCTTCGGTATAACC
GGTATAACTGTTTAAATTTCTGAAAACGTGCCTGGGTGTAATTGAGACCAGGTGTTTAAC
CAGGTGTTTGACCAGGTCTTAAACCAAGTGTTTAACCAGGACTTTAATCAAGTGTTTAAC
CAGGACTTTAACCAAGTGTTTGACCAGGACTTTAACCAGGTGTTTGACCAGGTCTTTAAC
CAGGTCTTTAACCAAGTGTTTATCCAGGACTTTAACCAAGTGTTTGACCAGGTCTTAAAC
CAAGTGTTTGACCAGGACTTTAACCAAGTGTTTGACCAGGTCTTTAACCAAGTGTTTGGC
CAGGTGTTTGACCAGGTCTTTAACCAAGTGTTTAACCAGGTGCTTGACCAGCTCTTAAAC
CAAGTGTTTGACCAGGACTTTAACCAAGTGTTTGACCAGGAATTTAACCAAGTGTTTGGC
CAGGTGTTTGACCAGCTATTTAACCAGGTCTTTAACCAAGTGTTTGACCAGGTGTTTAAC
CAGGTGTTTAACCAGGTGAGAACTCGAGATACCAGGACAGAGTCTCGTTCACGAGAGTGA
CCCGGGTCATGCGTGCGTGCGTCCGTCCGTCTGTGCGTGCATGCGGCACCACTCGCCGAC
TGCCACCGTGCAATTGAGTGAACATTTAAGTCAGGGTAATTTACAATATTTTATTGAAAA
CTGAAATTGTCGCATTTTAAGTGCTTACAATGAGAAAAATAACGACGATCAATAATTTTA
AGACCCTGTTTTTGTCTTCGTCCGGACGGAAAAGGAAGGAGTCCGACGTTGTTAGACGAG
TGACGCGCCGTGAAACGCGACCTTCCTGAAATCGGCCCTCCTCCTACAACGTCCATTTCT
TGGCTTTTTCGTTCAAGCAGGAAAACTATTTTTGGATTTCATTGCTTTTGTTCAAGGTTA
CAAACACATTATTTTGGAAACATCGCGTGAACACAAGTATGCGTGCATAATTATAGATTA
CACTTAAACTAAAGGAATTCCAGCAAACTATAATACAAAGACAAAGATCCCCCATCAGGC
CTTAACAGACGAGGGGGTGGTGTGGCCAGCACCATGCTCAGCTGCCGTTGTCTCCCCAGT
GTTGATCTTTACACACAGCAGCAGGTACTCATTTAAGGCTGAGTCAACCTAGAGGAGGTC
CAGGATGTTTCAGATATCACTCAACACGGATTTCATCCGTGGCTGGAATTCGAACTGGTG
TCGCCTGGTTTGAAGCACTGTGCGCTAACCGCTGCATTACCTCTCCAGTTCGCACATACA
CACAAACATATACAGGTAGTCCCCGACTTACGATATTTCGATCTTATGATGGCGATAGCG
ATATGACAATATTGTAAAATATTTTAAATTTCGCGCGGCAGGCAAACGCAGCAGCGTACG
AGGTACGATATCGTACTTTATCATCGCCATCCTCCTATTCCGACAACTAAGTTAATGTAG
CCATCAACAACCTAACATCGTTCAAGTATGCAGACGACGGACAGAATCTTGGTGAGTACA
GTAGAATATGATACGTTACGATACGTTCAATGCATGTTAAAAGTTTTTATAGGCAGGATA
GGATTTTTTCCTGAAAAAACTTTCTGTGAAATTGCAGTACATATTGGTAGGCTAAGAATT
TACTTTGTTTTTTTTTACTTTCAATTTTACTGTGCAATACAGTATTGTCATTAATAAATA
CATACAGTATATAGTTATACAGTACGGTACTGTAAATTGCTCTGTTTTGCTAAATTATCA
CCATTCTGTAAGACTCCTGGGTAGGCTAGGCCATTGTCGACTTACGATATTTTCGACTTA
CGATGGGGTCGTCGTAACGCATCTCCATCGTAAGTCGGGGACTACCTGTATACACATACA
CACACCAACCCATATTTGCTGTTGGGTTAGGCCATGCGCTAGGCTTATACCAAAATTCTT
GCCATTATCCCATGCACCATCCAACAACGCCAAGCTTACAAACACATTACAGGTTTCCCT
CCCTTAACGCGTGAGTAGGTGCGTTCCAAAAATCGGGCGCACAAAACAAATTCGCACAGA
ATGGAGCCCACAGTCACCCAACTCACAATGCCCCCGCGCGAGACAGCCGCCTGTCGAGTA
GCGAGCATAGTACACACACACAATGTTGTCCCACGTCCGACCGCAGAGCTGCATGTAGAG
TGAATTCAAACCGCGTAACGTCGTGAATTTTGGGTCGAAATAAGTTAGGCGAGTATGCGT
GAAATCACACGAGCCGAACCCACACGGAGCGAGGGAAACCTGTAGTTAAAACGCTATCAA
TGTATTGTTCAATTTCTGACGAGTAAAGCTCTGCACAGGAGGCTTTAGACTTTCATAGCT
GAATTTAACATTGCGCACAAGACAAAGATATCCTGTATAGCCTGAACAGACTGATGAGGC
AAGTGCTGTTAGCGAGCACCTATGAAGGCCGGCACGGCACACAAGGGCGTGGGTGGCCAG
CACCACGCCCGACCGCCTTTGTCTCTCCAGTGGCGATGTTTACTACACACAGCAACAGGT
ACTCATTTGAGGCTGAGTCGACCTCAGGGCAGGCCCGAGACCGGTTCAGATAACCGTCAC
TGGTGTTGGCCGTGAGCGGGAATCGAACTTGGGTCGTTGGCTTCGGAGCGCAGTGCGCTA
ACTGCTACACTACCGCTAACCCCTGCACACACACACACACACCGACATACACGAAAAAAA
TTACTTGTACAAGAAGCGTTGGGAGCGAGAGTCGCACACGGGGTCAACGACGCTCGCTCG
CTCGCCCTACTGGGGCACACACGTTCTGCCGGCGCTGAGGGAAAGGGCTGTGCCTGTATT
TGTGCGCAGCGTTCAGAACGCGTCTCTGTGGAGCGGGGTCCCTTTACAGACGCTTCCTCA
TGAAAAAATACCCAACACGCGCAAAGCCCCGTGGCCGCAGAACATGGTGGCAGCTCGCAA
TTGTTATGTTGTCGAAGAGACGCAATTAGCGCGGTCGGCAAACGTACGGCGCGGAAAAGA
AGTTCAACGTACATGCATACACGTGTACATACTACGTGGGCAGTCGTGCACAAGCACAAA
AAACGTAAACTCAACACCTTCGTGAACAACACTGCTGCCCCTCTAAGGAAGCTAACATCG
TGCCCCGACTCGGAGTGATGACCGCGCTCTCCGGGATTGGAACCTGGGATGACCGCCGGG
CTATTTGTCTGTACAGGGCCCAGTCGCTGAAGATGTTTAAAGTTCCAGGCGAAGACCCCC
ACCAACCTGTTTAAATATGCCTCCTATCTCTCTCGCACTCTATTTTCAGTCCTTCTCTCC
CTAGTTACCGATTTTCATCCTTTACACGCACAGCACTCCGAGATCCTATTGTTTAAGGGC
GCCGTATAAATTTGAATCGTGATTAACTGGTTGACGTTTCAGGCAGCGGCCCGTCTTCCA
TCACAATGGCCTGTGAAACACGGCGTCTTCACGACAACCTTGCCCGCTAAGAATGACGCG
GATACCAAACGTAGCGATGGGTATGAAAGTAGGCCCATTGTACGAATTATCACGTTCAAT
TTTTGTTCCTCTTTAGGGCAATGTTACTGACGATTGTCTTCAGTTTTTGTTTTATGCGCA
AAGGTTTTTGCCTCGACTCTCCATCGTAAATGCGCGTCATCTAAAAAAATGTGTGCAGAA
TAAATAAAACAGCAAGGACTAAATAAAAATGATAGCGTTCATATTCTTGGTTCTTTCGGT
AAAGTCACGTAGAAGGGAAACAATAAAATAATAAAAATATAAAACAATATTATTGTTTTA
TATAATATATAATAAAAAAATAAAACAATAATATTGTTTTTATATAATAAAAATATAAAA
CAATATTATTGTTTCCCTTCTACGTGACTTTACCGAAAGAACCAAGAATATGAATCCCTG
CAGTCACGAAAGCTTTAAATCATGAAAATTCCTCGTCGTGTTCCATTTATAAGGCAGTGT
TGAATGTGCGCAAAACAAAAAGTAAAAAAAAAGTTTGGCACAAACAAACTATCGTATTTG
CACTGCAAATAAATTGTTGCCAATAAATAATCGTTTCTGAGAAATAAACTGAATGCATTG
GGAGACAAATACAATTTTTTTTTACCCAACTGTTTTTATGTTACACGGTTGAGAGAAAAC
ATCGTGTTAACTTTAATCGCACGTAAACTGGGGCTTTGCGTCTTCATAAAAAACCATCAC
AGTGAAGGCGTTTAAGTCATTTGATGTGAATTTCTGCAGTAAGGCACCGTTAATGTGCAG
AGATACAAAATAGGTAAATGAACGGGGATTATTCCACGTGTTCCTTAGGTTACCCGCCAC
TGTGTAAATATATAAGTATGCTCGCAAATCTCCCAGTCCATCATTTACGCTAATTGATCA
CGGTAAAACTGAGGAAACGCGAGATATAATTTGTCTCGTGTTCCACTAACTGGGAACGTT
AATTTGTGCGCAAACAATAACAATAATAATGTGTATGTTGAACTTCTTTTGCACCGTACG
TAGCCAACCGTGTTAATCGGAGGTGTGGACCAGCTTATCATTAACAATGTCTTATAACAG
AAACAATGTATAGCGTGTGGCTGCATATTTTGTATATTCTGTTCTAAGGCAGTGTTAATA
GTAAAAATAACTAACTTTAACACTATACAGATATTCTGGCTCATCTCTTTGTACCATTGC
CTATGCGTTATCTCCGATATTCCAATTGCCGATTTCGTTTTTCCTCTTTCCAAGAGCAGT
GGACGTCGATGTAAACTGTTACAGATCCCCTTAAGGCAACAACAGTATTTACTGCACTTA
TTCTCTTAGTAAAAAAAACAAGAAGAAAAATATTCACCGCTGAGCAAGATTTACAAAAAC
TGTGACCTCGACACCGACCCCCATGGCAGGTGCCTGCACTCCGACTCTTAAACGCTGAGT
AACGAGCACAGCTTCTGCTGCTGCCGCGCCGTAAAGTCTCTGAGCCAAGCTTGCACCTCG
CTCAGCCGGTACCCCTCGGGCCCGCTGGGGCCCTTGTAAACGACGACGCCGGCCTGCAGG
ATGTAGAGGCGCAGGAAGGCGGTGCCGTACGCCGCCGTCGTCTCGTTACGCATCGTGTCG
GCCACCACGGGGCACGCGGGGCCCAGCAGGCCCGCCAGGCGGTGCGCGGCCTCCAGACGC
TCGGGCAGGCTGCGGTGGCGCGGCAGCTGGAACGGGGCGTCGCCGGTGCTCCACCCGTCG
AGCGGGTGGGCCTCCTCCACGTACACCAGCAGGAAGTCGGCGGCGGGCCTGAACTCCCGC
GCCAGCCGCCCGAATGCGCCCAGCCGCGCCATGAACGGCGGTCAGCTGCCGCTGCCGAAG
CTCAGCACGAGCGGCCGGGAGCCGTGCGCGAAGTCCAGAACGCGCGCGCTGGTGCTGCTG
GCGTCGCCGCCGCCGCCGCCGCCGCCGCTCGGGCCGCCGCCGCTGTCCAATCGCTCAACG
GGCGTGTTGGGCGCGAGCCCGCCTGCCCGCGCCTCCTTGAACGCGTCGAGGACGTGGCCG
CGCCACACGGCGGCGAGCGAGGCCCGCGTGAACGTGCGTTCCGAGTCGGAGATACGCCAC
GGCGGGTCGGTGTCGGCCGTGCCGGAACGGCGCGCCTCGTCGGCCAGCGAGCGCATCGCT
CGCCGCCGCACGCACGGCAGGTCGAGCAGGCAGAGCGCCAGGGCCGACGCGAGGAAGCGC
GGCACCACCAAGAGCCAGCGCGCCAGCCGCTTGAGCAGCGGAGGTTCCATCGCGACAGTG
CCACGCGCGTGTGCCGCGCTTTCTCGCACCCACCATCGCGCCCCAGGTTTTATACGGCAG
TGGCAGTCGGCTCTGGCACCCGGCCAGCCACTCCTGCATCCCCATCTGAAATCGCTCCCC
CCCCGCCCCCCGCTCTACGGTCGCAAAAAAAAATTTCTCATCCTTGTTGTGATCGGGAGT
CGTTTCTTTGATTTCATTTTTGGCGGGGTGCGCATGCCGATGCACGATCGTTACATAACG
TGCCGCTGCGGTGGCGTGACTTTGCCCGCGAATTCCTGAACTGTGAGAATGAGAAATAGA
AAATATATTTTTATTTTTTACTGAGGGGGGTGGAGAGGATTTACTGCAAAGGGAGACAGA
ATTATTTGAGTATGGTCCAATTTAAATGTACCCTGTGACTAGGGGCAAATGACACTCTCC
CCAAATTCCACACGGTGCAAATTCCCAATGCCTTGTTTCTGTGATGAGATACCATGCACG
GGGGAGGGGGGGGGGTATGGTTAAATACTAGAGGGTCTGCAGTTGCGATCAGGATTGGAG
ATAATTTTTATTTCGTGGTCACTTTGGTGGGGGGGAGCGTTGGCGTGGAGGTTCGTGCAC
TGCTTCATGAACCCAGGAATCCGTGTTAAGATTCCCAGCCACGGCTAACATCAGTGATGA
GTGATATATGAACCGGTCCAGGGCCCCAATCAGCGTGGTGAAGTATGGTCATACAACCCC
CACGACTGACATGGTGTCAGAGGCCTTTATCTGGCAGTGCATTAGTTGACATATAAAAAT
GTATTTGTCGGCTTTCACGACTAATATTATGATATTTTTGTGGCGTGGCTTCTTCAAAGT
AAAACTGCCGTGCTAATTCTGTGGGCACAATACTTTAACCCACCTTGTGTTTCCTTGGGC
CAGGAAATGAATACGGTGCAATTAACTTGAGAAATGCGCAATTCAGCGGTGCCTCGTGAG
ACGCGCGTACTTTCAATGAATGGGTCGTGATGCTCCTGGGACACTTGGTGGCATCACACA
AGGGCATCTACACTAAAGCATCGCAATTAAAGGAAAATAATATTTTAGGTGGCTTACCAT
ACCAGTTCATGCCTCTGACAGGTGGCCACCAGTTCATTATGGTTTGGAAACCCTGACTTA
CGTGAGCTACGTGGTTGTGCTGAGCCGAGTGAAGTCACAAGAGGGCCCGGGCACTCCATC
ATCGCGAGCTCCGTCTCACTCAACGCAGCCGCTCTCTCTCCACCTCCGCCCTCCTGATCA
CAATCAGAGACGGCGGAAATTTACGAACGAGCGCACCCCAGGGCGCGATTTACCACCGAC
AATATTTCCCATGTCGCTGGTAGGCTAGCCTAAGTGGCACACGACGAGAGGTGGCCGCGG
CCGTAGTGAGAGAAATTACCCGACGTGGTGTACCGACTGTGTAAATATTTCCCGGGTCAC
AAGGCACAGACAGACCCGCCTGAAATGAATCCCTGAGCGGGCGGTGTCCCAGGGGTGGGG
ATGTTCCATCCAGTGCCGGCGGAGAGTGGCCGTAAATCTCACAACGTTCATTTTCGCGCA
CGGGACGAACCGCCCACCGAGAGGTCAGCTCGGCTCAAATCGCTGCAGTGACCCCGCGTC
GCCGACAGAGAGTGTCGCGGTTCTAACGCAAGAGAGGGGCGCTCGTAAATCTCAGCAGAG
GAGGAGGAGGTTCATGTTCGCTCAGTAGGAGGGAGGGGGTCACCGAAACCACTGCGGTGT
AAACTACGACAGGGTTTGCCAAACTCCAGTCCTTGCGACCCGTCACCACCACGCTAATTA
TCTCTGCGGTTACCAATTTACTCCTCCCCATACTAATAGAAAATTGACTCGTTCCACCCT
GCACATGCCCAATGATTGTTAAATGCGTCCCACGTGACGCACTAAGCAATTAACGCTGTC
TGTGTCATGTGGAACACGCGTACACACACGTGACGTGTACACACAAAGAGACCTCCATCT
TAATTTGAATTGGCTCGATTCACACGGATAAAGTCCATTCAGATTGTTCACTCCATGCTT
GTAATCAATGTGCGTTCAGAGTATTTGTCTGCTATAAATTTCTACGCGACAAGCCACTTC
GTTGAGCTATCAATTTTCGCCAAGTCGCTCGTGAAAAAGAGCTACATGGCTCAGTGAGCC
TTACCTGTAAAAAATAAAGTTTTGTTTTAAGGAGAGGCTCGCGTACCGCCACAGGGTGGC
GGAGGGGCACGGCTTGAAAGCGCAGGCCACCAGGTGGTGCCATTGCACAAGTCTGGTGAA
TATTGAGGGAACACATTTTGGACGATACACCCCCAGAAACGAGAGAGCGCCAGCCCACCA
GGACATTCACGCGTACAACAACGGGGCGGTTGTTCGCGTCTATTTTAATTTTACCAGGTA
AGGCCCACTGAACTGTACAGCTCTTTTTCAGAAGCGACCTGGCCCCAAATGAAAGTCAAC
GAAGTGGCTTATCATGCGCAAATTTGTAGCATCCAAATACTCTAAACGCATGTTTCTTAA
TGTGGAGGACCCCGGAGAAAAATCCACGCGACTGTGGGGAGAACATGCACAATCCAAATA
TACAGGTGCCGGGGTCGGTATCGAACCCATAACCATCCTTCATACTAGGCGAGGGAGTTA
ACGTCCGCGCCAGCGCAATGCCCCATATTGATTCAGCGTAATGCCCTATATTGATTCAGC
GTAATGCCCCATATTGATTCAGCGCAATGCCCCATATTAATTCAGTGCAATGCCCCATAT
TGATTCAGCGCAATGCCCCATATTGATTCAGCACAATGCCCCATATTGATTCAGCACCAT
GCCCCATATTGATTCAGCGCCATGCCCCATATTGATTCAGCGCAATGCCCCATATTGATT
CAGCGCAATGCCCCATATTGATTCAGCATAATGCCCCATATTGGTTCAGCGCCATGCCCC
ATATTGATTCAGCGCAATGCCCCATATTGATTCAACATAATGCCCCATATTGATTCAGCG
TAATGCCCCATATTGATTCAGCACAATGCCCCATATTGATTCTTAAGGACTGCTTGTTGT
TGTGTTTAGTTTGTTGTCCTTCCCCCGCACCTCCAATTAGCACGGTTGGCTATGTACAGT
GCGAAATAATAAAATACCATCTCTCACGGTCCTGGCATGTACTAAAAATCCATCTCGTGC
CACGGCACGTGAGCTGATTTCCCTGCTCCATTGAGGCGGTGGTCAGATCCTTAGGCGCGT
TCCCTCCTTTGGCTGCCATCCCATCATTAGTCTCAACCATCGGCCAGGATGGCACTGGAT
AGCGTGCAGAGAAAAGAAGCAAAAAACATTCGGCCCCATAAAAAAAATCGCCCAGCCAAA
AGAGATAATGAACGGACATCAGCGCGTGGTGACAAGCGAGCCAGAGCTAGTAATTGTTAA
ACCAGGAAACGGTTCAATGATGGCAGGCGTCAGCTGTCACTCTCAGCGTGAATGTTCCCC
ATACGATGAGAAAACAACTACTGTGCGAAAGAACAAGATGTACTTTCCGGGATTTATGTA
TTAATACATCCTGCCAGTTAATTGAATCCAGGGCAATGCGCCACTGTGGTTCTCGTCCAA
GCTTCATTTGTCACTGCCGATCAGTGCTGTTTGCGAACTTGTAGTTATTTATTTATGTTT
CTCCGGCAACATGCTGATCGCAAATTCTCATAGAGCTGTACGTAGCCCTGTGTTCCACGG
AATGAAATGTGGAAGGTGATATCACAGAAGCACATCTGATCATTCTTCCTGGAACCTTTA
GTCCACCCCAGGAGTGATGCACTTCTCCCACACCACGAGGTTTAATTTTTTAATTAATAC
TTGGAGCTGGAATTTAGCCAAATGAAATGAAAAAACACATTTTTAGCAATTGGGATTTTC
CGTGCGGTCACTGGCATCCAGGCAGAGACACTTTATTTCTTCGATTTGAGAACCTCACCT
GACCGGGAGCTGCACCTATGCTCTCACTCAGTGGTAAAAGCTGAATGCTCAAACCAGCAA
ACAGATGGGCCCTGGAGCAAGGAGTGAAATTGGGCCCACCCCTGTCCAATTCCACCCCCC
CCCTCTCCGACCTATGGGGCCCCGATGCAGTTGCACCGCCTGCTCACTCAACAACCACGC
CACCGCCCTGACCGCCGAGCAACCGGGCCACCTGCCCCGTCTAGACGTTGCTCTAACGCT
GCCGGGCGGCAGCTGAGCATCGGTGCCGATGGCGATCGGAGCGGCGGGAGAGACGGAATC
TCAACTGGGCTCTCTGTGCCCTCCGCTCTCGCGGAATGGCGGCGGTCGCGCAACCCGTGC
ACCGTCGCATCGCTCGGCTCGATCGCGCGAACTCATTAACGCAACACAGCGGCGCGCCAT
TATCCCCAACGAGAGAGACTTGACCCCCTCTTAGTCGCGTCTGAGTCACGCCGGCACCGC
CCGCGGACCCCTCGAGCTGCTTCCTCGAGCAGCGCGCAGGCCGGCGGTGATGCGACGATG
TGTCTCCTGCACGTGCGTGCGTGTGTGCGTGTTCGCTGTCCATGTGTACAATGTGAGTGT
GTTTGCACATTGTGTATGTGTGTGTATGCTGTGTGTACGCTGTGTGTGCATGCTGCCTGT
GCATGCAGTTTGTGCACGATGCGTGTGTATGCTGCGTGTGTATGTTGCGTGTGCATGCAG
TTTGTGCACGATGCGTGTGTATGCTGTGTGTGCATGTTGCGTGTGCATGCTGTCCGTGCA
TGCTGTTCGAGTGCGAAAGTTTGTGTTCGTAAATCGCCATTGCCATCCTGTGTCGTCCGA
CAGCTTACGGCTATTTTTTACACGTGAGATACATGCACGAGTGAATTTGACGTGGTCGCC
TTTCAGTGTGCATTAGCTTTATGTAGGCCACTCGGCTTTCCATAATTGTAATATTATTGC
TTTAAAATGCCCTTTATCACCGAGTTTCAATGCCTCTCTTAATTTTCAACGAGTCCTC
Chart Advanced