SelenoDB
Release 2.0
Chart Advanced
Sequence Report for SEQ00002010_2.0
Identity
SequenceIodothyronine deiodinase (DIO)
SpeciesPelodiscus sinensis (Softshell turtle)
DescriptionGenome -assembly-
Sequence IDSEQ00002010
Sequence release2.0
External IDNone
Gene SPG00002014_2.0
Annotation
Prediction method(s) None
OrientationReverse
Toolbox Forward Reverse  
Sequence
>SEQ00002010_2.0 # Sequence # Iodothyronine deiodinase  (DIO) # Softshell turtle 
GAAATCAGGGAGCCTACCTGGGGCTCCCTGCTGCATCCACGGGCCAGATCCAGTAGCTTG
GAGGGCCAGATCCAGCCCCTGGGCCATATTTTGCCCAGGCCTGATCTAAATAAATGGTCC
TGCCATGATGACTGGGCTTGGATAACCTCTCGAGGTCCCTGCTGGTTCTAGTGTTCTATG
ATTCTATGATTCAAGGCTTTGGTAATGATTGCTAGATGGTATGGAAAGGATAATGGAAAG
AGACCTACAGGCCTAGACTCATAATAATTGTCTAGAAAGACAAGGTGGTGGAGATGATAT
ATTTTAGTGTTGGTGAGACAAACAAAAGTTGGTGTAGGAGAAGATATGAGCTCACCTTTG
CCTGTAACTCAGATAGCTACAACAGCTCCACATAAAAGAGCTTAAGCAGTTCGAAGGCCT
TATACCAGGCCTGGGCAAAATACTGTCCGCAGGCCGGATTTGGCCGACCAAGTCACCGGA
TCCAGCCTGCGGATGCTGCCCTCCCCAACTGCCTCACCACACCTGCACAATGCTCAGAAA
TGCAACTGCGAGGCAGATTCACTTTAAAAACTGAGCCACGTGGGGAGGAGGGAAAGCTTA
GAGAACTGCTCCCGCCCCAGCACAATCCCATTGGCTGGCTTCTAGACCGAAACTGGCCAA
TGGGAGCTTCCTGTTTCAATAACGGGCAGCCACGAAGCACAAGGGGCTCAGAGTGATTCA
CAGAGCACGTGACTGCAGTTTGTGTGGCAGCAGGGCAGGCAGGGAGACTGATTGAGGAAC
TGCCTGCTGGCTAGTAGTTTACTGGCCAAAACCTGTTTCTGGAACCCAATCCCCTCTGTT
CCCCAATACTCTGCCCCCCACTTCTGCCCCCTACTCCACAAACCCAAATCCTCTGCCTCC
TTCCTGCACCCATACCCACTCCCAGATCGAGCACTCCAATCCCCTGCTGCAAATCACAGT
CCCCTCCTGCCCTAGCTCACAACCCAAACCCCTGCACTCCTCCTATACCCCAATTCCCTG
ACCTAGGCCACAATCCAACCACCTGCACCCCAGTCCAGTGCTCCAAGACACAACTGCCTT
CCTCACCCAAACTCCCTCCATTATCCCAAGGTCCCATCTGCATTTACCTCCATCTCAGAC
CCTGCACCTCCTCCTTTAATATCAGGGAAGAGTGCGGCCCTTGACCACTTTCCAAATGCC
TAGAGTGGGCCCCATCAAAAATTACTGCCCACCCCTGCCTTATACCATAAATATCCCAAT
GAGTTGCTCAATCAGTTAACATCAGTAAGAGCTTCAGTCACAAAACACTAGAAGGCTGTG
CCTATTGTTCTGGTATGATAATAGTAATAGAGATGTAGCCATGTTAATCTGATCTTGCTG
AAACAAAAGACAGGACTATGAAGCACTTTAAAGACTTACAAGATGGTTTATTAGGTGATG
AGATTTCGTGGGCCAGACCCACTTCCTCAGATCAAATTGTGGAAGAAAATTGGCATGACC
TTCCATTTCCAGCCAGCTCTGACGATGCTTTTGTGGTTGTGCTCAGAAATGTCACTGTAA
GTTCCCCAACGAAAGGCAGAAGAATTCCCACTTCTCCTGTTGTGTTCTTACTGAGAGATC
ACCCTTCCCTTTGGATCTGTACTGGTCCTGTCATACATTGCTACCCCCAAACGTGCCCTT
TTGGTTTGATTCCATTAAATCTGTGTATGTGTGTGTGTTTGATTGTGCATGCGCAGGCAT
GTGTGTGTGTGTTGAATTTCCAAAAGACTGGTCTTATGGTGCTGGCACAAAATCTGGTTT
CATGAAATCCCACTACTCTTTTGGGGCATGCCGACNNNNNNNNNNACCAGCTCCCTGCAT
TCTTCCATTCCCAGTTTCCACCTGGCTAATTTGTTATTCTTTGATGCATATTGAAAATGC
TAAGAACATGCAAAATGTTCATATTTGTTATTGCTCATTTTATTTCTACTCGGGGGGGGG
GGAGGGTTCACGTCATTACCCATTATTATGGAGTTCCTTGTGAAAATTAAAACATCTGAC
ATAAAAGAAATTGCATCTTGCATTACAGGATCTTTCCTCTTCCAGCCCCTTTTCAGCTGG
GAAATGAAACAAGTGCAAATCACTAGAACTCTGTGTCCCTAACCCGGGCTGTGAGATTGG
CCTCTTCTTTCCTGCATTGAAAGAAGCCAATGCATGTCCAATGTCACTCTGGAATGAGAG
AATTGACGGGAATTGACCTCTCCCATTTCAGGAAGAATGTCAATGCCAGAAATGTCAGTG
ACCCTCCCTGGGTTTCAGCTTTCATCCATTGGCGATGGTGTTGGCCCGACATTCTTTCAC
TCTTCGGAGGGCTTTAATTATTTTGGTCTCCCTATTTACACTCCTGGGAGCAGCCCCCCT
CATGTGAGTTAGGAAGTTAGTGGGAATATTTGCATTTGCATGTGTGAGATCAGCATTTGG
CCCTGTAGGAAGAAATCTACACTCATAGCCAGGATGGGTAGAGATGGCGTCTCTTAGCCT
CTGTTTGTCAGAAGCTGGGAATGGGTGACAGGGCTTCTAATCACATGGGTGATTATCACT
TGATAATTCCCTGTTCTGTTCACTACCTCTGGGGCACCTGCCATTGGCCATTGTTGGAAG
ACAGAACACTGGGCTAGCTGGATCTTTGGTGTGACCAAATATGGCCATTCCTATGTTCTT
AGATCCAGGCAGGAGACGACAATTGTAAAATAAGGGCTGACTTCTTGTGCCCCAGATGTG
GTAACTTTGGCCCCTTTAACTGTTCAGTCATGACTCATCACTTGACAGGCAGAAAGGCAC
ATTGAGGGTACATCTAGACTACAGGCTTTTGTTGACAGACATTTTGTCGACAGATACTGT
CGACAAAGCTTCTGTCGACAGAGCGTCTAGACTAAAGCCAGTTCTGTCGACAAAGCAAGC
TCCTTTGTCGACATGACAGTGTAGACACAAAGGACAGTGTAGATGCAATAACACCTTCTG
TCGACAGAACTCTGTTGACAAAAGGCGTTATTCCTCAAAGAATGAGGTTTACAGTTATCG
ACAAAACTGCTGAGTTCTGTCGATGTTATGTCAACAGAACTCAGCAGCAGTGTAGACGCA
GGTATAGTTTTGTCGACAAAAGTGGACTAGACACACTCTGAGTGAGAGTCTTTCTGTCTC
AAATTGTACTCACAAAGGCAAAATTGATCAAACCTAAATTGGATGGAGTTGTGACTCAGT
TTCCCACTCTACACTGCCAACAGCCACTGACACAAAGTGACTAAATAGGGTCAATCTCAC
AAAAATGCCGATCTCTGCTTCATGCATTCATTGGGCAAAGGAGTCACCCTCAAAGAACAC
TAATGAGAGCAAGAGTCCATGGCCAGGTGGGTTAGCAGATTCCCCATGACATGAACACCT
GGCAGTGACAGCACTCTGCAGGCACAGCTGAGCAGACAGTGTCAGGAGGAGGCCTTGCAG
CATGAACAGGGGCAGTTGAATTGACACAAGTACACAAAGCGAGAGTGAGTGTCACTCACA
AGCCATCCCAGGCTCTGTGCCTTGTGTGGGCGCAGGCAGGTGTGTTACAAGCAGCAGGTG
GGGAGCCATGAGGGGCTGGAGGATGCCAGGGTGCGATACTGTCAGTGCGGGGTGGCAGCA
GATGTGCGATCGCATAAGCCCCATGGTCAGTCACTAAGGGGGTGCTCCGAGGCGTGAGGG
GAGGAGACCAATGAACTAGGGGAGAAGCTATCGTGATATTCCTGCAGTGCTGAGCAAGAC
ATGAGGGATGGCAGTGGGGACCCTGCTGGATCTGCCTTGGGCACATGGGCACCCGGTTAG
CACATTGTACACTTGTCCCCTGGGCGCTGTGCTGGGGGAGGGGCCGGGGTGACGCCTGTG
CGTGGGGATGCCGGTGGGGAGGGGAATATTCCCTCGCTCACCAGGGTTTGGTCACTATCT
GTCCTGCTGCCAGGTTCACCCCTGACCTGGGAGGAAGGGGTGTTGGTACCAAGGTGTCTC
CTCACCAGCTGCTCTGTCCTGGCCCCTCGGGAACATGCTCCCAATCTGGGCCTGGTGACA
ATTAGTGTGTGACCCCGTTAGGCCTGATGCTGCCGGAGTCTGAGCAGGGCCTGCCTCTCG
CTCACTGTCACTGTGCAAAGTCCTGACGGCTGTGGCCTGGGCCTCAGGTCTCACGCCCAG
TCTGAGGTACGTGGACTGAGTGCACACATGAGGTTCTGCATCCTCCCACACAGAGTTTGT
TCTGATACTCCTGAGAGTTCACCCTGACTCTGGTCCTTCTGCTAACTGACTGGAGCCAAA
GGGACCTGCCCCCTGACTGCTCTGGGCTGTGGGGCTGGCCCTCGAGGAGGGAAAGGGGCC
CTGTGGGTGGGGCAGAGGGGCTCTGGGAGTGAGGACTCCTGGGTTCTGTCCCCAGGCCTG
GCAGGGGAGTGGTGTGTAATGGTTAGAGAAGGTGGGGCTGGGAGTCAGAGCTCCTGGGTT
CAAATCGTGGCTCTGAGGGTAAGAGTAGAGCCCAGAGTCTGAACATCAGGAGCCCTGAGT
GTTTCTCTTGCTCCTGTCCCTGAGTCCTTATGTTGTGTGACCTTAGAATGCCCCTTCTAG
ACAATAAAGTGTCCCACAATTTGCCACTGTCAGTAAATCCCATCACGAATGTCAGAGAGA
AACAGGCCTGATGATACAACGTCCTCGGACATGACTGACCCAGTGACTGTTGCTTTGTTG
ACATTTGAGGCAGGTTCTTCTTCCTCCAAGGAATATGGCAGGGCCGGCTCTAGGCACCAG
CAAATCAAGCAGGTGCTTGGGGTGGCACATTTCCAAGGGCGGCGTTTCCAGGTAAGCAGC
CGCCCCCGGCAATGCCCCGGCCTGACCCCTCCGATTTTTCTGGGACTTAATTTCCAACTT
TTCCCCATCAACACGTCCATGTAAAACTCCATATTTTGGTGCTTCAGAGGCATCCCAATG
GTCTGACAGAAAAGTTTATTGATTTTGTTGCCTTGGGCATAGTCAAGGATCCGGAGTCGC
TTTTGCCTGTCCAGCTGGATGACTTCGGAGCTGGGTGCGGAGGAGCCCACGTTCGCCGAC
TTGAAGGAGTCCAGCTTCTGCCCGGGCCACACGGCTCTCAGGGACTGCAGGGGAAACATG
CGGTTGGAGTCGGACATGCAGACCGGGAGGTCGTCAGAGGGTAGTTTCTGGCCAGGGCTG
GCTGACTGCCTCCTCCGCCCTGCCCATCAGCAGCACCTTCTTCTGGACAGGGGCGGATAA
GGGTTTTGCGGAGCCCAGTGCAGCACAATTTCATGCCCCCCCCCTTTTGACATGGCACAT
ACGTGGGGCCTCTTGAAGCCCTATATCTGCTGCTGCTTCCAGATGCACAGAAAATCCAGG
AGCCAGAGCATCAGCGTGGGGAGCAGGAAGCGGGGCAGCAGAAGGAAGCAGGCAGTGCCT
GGGTGAGCAGTTGCAGGGTGTGAACCCCGAGGGAGTGGAGCATCGTGAGGGCTGCTGGGC
TCCGGCTCTCGCCCCTTCCACACACGCCCGCCTGCCGGGCTCCTTGCAGCTCCGCTGTGC
TCCCGCTTCTCTTTAGGCCCATTTTATAGTCAGGGATTTCAAGGAAAAGTGACTCCAGCT
CAGGCCAGACCCCGCCCCCCTTGAAACTGAAGCCTGGGGGTTACCTCCCCCACCCGCGCC
AGTGAGCTAGCAATGCACAACGTGGCTGGAGGCTGGAGCCCCGCCGCGAGCTGCAAGGGA
CGTGCCACAGTGCAAGGAGGCAGGACGCTGCCGGGCTCCAGAGGCAGAGAGCAGGCCCCA
CAGCCCGCCCGGGACAGGGCAGCACTGTAGGGGGGGGGGGCCCGCAAAGTGCAAATATGT
GTAAAAGCCAACAAAAAGTGTGGGGGGGAAGCCAAAATGTTTTTTGCTTGGGGCAGCAAA
AAACCTAGAGCCGGCTCTGGCACAACCACAGCAGTCTCCTGTGTGAGGCTGCCAGGCGAA
TGTTGCAAGTGGTGGCCACAGGGGTGCTCTCAGACAGGCACAGAGGCAGGAAGACAGGAA
GGCAGGAGGAGGAGAGGCAGCCTGTGTGTGACAGAGGGGTCCAGGTGTTGGGGTGAGTGA
GATGTGTGGGTCATAGTAGTTAATTTCAAATATATATAAATGTGTTGTGTGTTTATGGCT
GTATATTAATGATCTTAATTTTAAAATAGTGATTTTATATAAAACAAAATGGAGTCGGTC
ACGTTCGCCCCCTGGGCTCCATCTTGGGCTTTGCCCCTCCCCACCATGACGCGCTCAGCG
ACCGTTGGGAACCGGTTCCAACCGGATTTTCCCGCCTTGCTGAGAGTTCCGCTCCCCTCA
GGGCTCCTGCCAAGCAGCCTGGGAGGGGCCAGTCACCACCCCAGAGGCAGCCAGAGCCGG
GTCCCCCCCCACACACCCCCCTCTCTGTCCTTAGCCATCCCCCAGCCTCATCCACTCACC
CGCCTCCCTGCTCTGCCTGCAGCTCTCTCCTCCCCCCAAATAACAGCAAAGGACTGCTGA
GCCCCTTTCGAACGTCAGGCCCCATCAGTCACAAGATCAGATATTTGTATCAGGGTCTCC
TGCCTTGACTTCTCTGACATAACCAGGGTTTACCCAGGTGGGCCTGGGCTTCAAGCCCAC
TGAATGACTCATGACATCACTAGTTTCTTTGTTGTTTGGCTTGCTGGCACCTCTCTGCCC
CAAGTTCCCTGATTTTGTACCATCCCCTAATACCTCAGGGTATGTCTACACTACCCCGCT
AGTTCAAAATAGCGGGGTAATGTAGGCATACCGCACTTGCAAATGAAGCCCGGGATTTGA
ATTTCCCGGGCTTCATTTGCATAAGCAGGGAGCCACCATTTTTAAATGCCGGCGTGTTCG
AACCCCGTGCCACGTGGCTACACGTGGCACGGGTTGCAAATGAAGCCCGGGATTTGAATT
TCCCGGGCTTCATTTGCATAAGCGGGGAGCCGCCATTTTTAAATCCCCGCTGGTTCGAAC
CCCGTGTAGCGCGGCTACACGGGGCTCGAACTAGGTAGTTCGGACTAGGTTCCTATTCCG
AACTACCTAGTTCGAGCCCCGTGTAGCCGCGCTACACGGGGTTCGAACCAGCGGGGATTT
AAAAATGGCGGCTCCCTGCTTATGCAAATGAAGCCCGGGAAATTCAAATCCCGGGCTTCA
TTTGCAAGTGCGGTATGCCTACATTACCCTCCTAGTTCGAACTAGGAGGGTAGTGTAGTC
ATACCCTCAGTCTTGGTTTACTTTATACACAGCTCCCTCTTCATTTGGGGAAGGGGAGAG
GGTACGAGGCACTGGGGTAAACCGCAGGGGACAGGCCATAGATCCGAGGAATGCAGCTGT
GATCTTCAGACACCTCACATCCACACACCTTATCAGCACTTTGAACTTCTCTGTGCTCAC
GCCCTCCCATGTGCACACGGCAGCAGGTTTCTGAATGGCAGGGGGTGGGGGGAGGAAGTG
CTGAAGGCTGTAGAGAGGTGGCATGATGCACTTGCTGCCCAACCTCCACTCTTTATGCCT
GATGCCCTGTCTCTTCTGCTTTACCCCATCCCTTCATAGCCCCCCTGAGATAGACCCACA
TCCTACTGCCAGTTGCACCTTCCCACTCAAGCAGCATGGGGAGGGGCTGGTGCTGGACAG
GCAAAGCGGGAAGCCGGTCTCCTGGGCCTGCCTGCTGAGGGATGCTCAGTTTGTGATGAG
ACACCAAATTCTGGCCAACCCCCGGGGACTGTCCCTGCCGGGGAGGCAGCAGTGCACTGA
GGGGAGCAGTGGGGAGCTATCACACTCCTGCAAACACACACCCCACCAGCTGCCCTCATG
CTGCTAGTGAGAAGGCCAGGTGAGTGGGACGCAGCCAGGAGAGAAGGCTAAGGCTGGCGT
GGCTGGGAATCATCCCAGGGCTTGTTCTGTGGCTGGACGCAAACTAGGTTGTGCGCTGTA
CCATGGAGCGTGCATTGAGGGGGCAGAGAGTGAGGGGTGCGGGAGAGTCAAGGGGTGGTC
CGAAATATTGTCAGGGACTTTGAGTTTTCAGCTCCTGCTGCTGTAGACTCTCTTGGTCAC
ACAGAAACGTGTATTCCCTTTTTGGAAGCAATTCCCAGTCTTAGAGGTGTGAGGAAAATT
AATAAATCCCAAGGGCATTCAGTGTGGCTATTTGTCACAGCGAATGCAAAAACCTCTTTA
AAACCAGCAAATCGTCCTTTGGCACATTTGAGCCTAACAAAAGTACCTAGTATCATGAGC
TTTCATGGGTAAATCCCACTTCCTCAGATGCTGAGCTGGAGTAGAAAAAACAGAAACCTG
ATATTTATTAACAGAGAAGAAGGGGGTAAAAGTTACCTGACAATTATAGGGCCAGTGCTA
ATGAGGATAATGAAGTGGGCTGTATTCCTAGAATTTGTCACTGAGCATTTCAGTGTGGCC
TGTGATCATTTCAGGGCAGAAGTTGGGCTTGGACGTGGTATGGCCCTTGATCATTTTCTA
TTTGCCACCATTCATAATGAGCTGGATTTGCAAAGGTACTGGGGACTCCTTGACTTCTGT
AGGCGATTCAGGTCTCAAATGCTGCCATAAATTAGACCCGGGTGCTTGATCAGTGCCTAG
AGCATAAGGACAAAAATAATTCAGATGCTCCCTCCAAAGACACCTGAAGGGACATTGAAT
GTAGGAAACGAGGGTGATGCAATTGCCTTGAGTTCTCTGGGGCCATCATTTTCCTACTGA
GCTGGTGATAACATCTCACCAGGGTATCTCACATTGGAAGAGAGTCATAAAGCTGAAGGA
CAAAAGGCACAAATAGCTAATCTAGTTTTTTTTGCCAAAACAGGTGTCTTTATTTAACAT
TAGGAAGGGGGGCTAGGGAGGGCAAAGGGGAAGAGGGGGAGGGTGGAAGAAGGCCCCAGT
GGGGCATGCAGGGAGAGTTCAGTCCTCCTCCTCTACATGGAAGCTGTCCTGCAGGGCTTC
CCGGATCTGGACGGCCCCCCGCTGGGCTTCCCGGACAGCGGCGGTGCAGGGCTGAGCGTA
GTGGCCAGCCATGCGGTCAGCCTCAGCCATCCGGGCTGGCAGGAAAGCCTCCCCCTTTCG
CTCACACAAATTGTGCAGCACGCAACGTGCTGCCACCATGGGAGGGATGTTGTGCTCGGC
GAGGTCGAGATGGGTGAGGAGGCATCTAAATCGGGCTTTCAGTCGCCTGAAGGTCCCCTC
AATGACAATGCGGGCCCTGGTCAGCCTCGTATTGAAGGCCTGGCGGGAGGGGTTGAGGGG
CCCCGTGTACGGCTTCATCAGCCAGGGCTGTAGGGGGTAGGCTGCATCCCCCACCAGGCA
CACGGGCATGTCCACGTCCCCGCCCCGATGTGGTGGTCAGGGAAGAAAGTCCCGGCCTAC
AGCCTCTGGCACACGGAGGAGTTCCAGTACACCCTGGTGTCATGTGCCTTGCCGGACCAG
CCCACATTAATGTCCGTGAACTGGCCCCAGTGGTCACACACAGCCTGCAGGATCATGGAG
AAGTACCCCTTACGGTTGATGTACTGGGAGGCCTGCTGTTCCAGGGCACTGATGGGGATG
TGCGTCCTGTCAATGGCCCCCCCGCAGTTGGGGAAGCTGAGGGCGCCGAACCCCCAGATG
ATGGCATGTGGGTTGGCGAGGCGGACCACACTGCGGAGCAGCACCCGGTTGATGGCCTTG
ACCACCTGCAGAGAGACACAGCAAAGCGCGAATCACTGGGGCGCCCGGGTGGCTGGGAGT
GTTCATGCCTTGGCAGTGCCCTGCGCCCCACTCCCGGAAGCAACCCCTCCGGGTGGTGTG
TAGTACGTTCGGGAGAGACCGGCCCCTCCGGTGTGGGGCACTTTTGCCTCCTCCCCCCCC
ATTCCCATCCCTTCCTTGCAGCACCCCCACCCCCGTGACCCAGTGGCCGGGGAGTGCTGT
ACCTGCATGAGCACTGCTCTGACAGTGGATCTCCCCACGCCGAAATGGTTCCCGACGGAT
CGGTAGCTGTCCAGCGGGGAGAGCTTCCAGAAGGCGATGGCCACACACTTCTGGAGGGGG
ATGGCGGGCCTCATGTGAGTGTCCCTTCTGCGCAGAGCAGGGGCGAGCCACTCGCAGAGC
TCCAGGAAGGTGTCCCTCTTCATCCTGAAGTTCTGGGTCCACTGTTGTTCTCCACAGCGC
TCCAGGACGATGCGGTCCCACCAGTCACTGCTGGTGTCCAGACGCCAGATGTGGTGAGGC
ACGCCAGCACCCGGGCGCTGCCGCAGCTGCTCCATGGCCCCCAGGGTGGCCAGGCGAAGA
GGTAGGGGGCTGACGTGTACCAGGTGGTGCCAGGCAGCCTCCAGCCATTGCTGGCAGGCT
TGCAGCATCAAGTCCAGAAACTGCACCAGAAAGTGCAGGGTAAGCTCTGGCTCCATGTTG
CCACCTGCGGCGGTGT
Chart Advanced