SelenoDB
Release 2.0
Chart Advanced
Sequence Report for SEQ00001803_2.0
Identity
SequenceIodothyronine deiodinase (DIO)
SpeciesOryctolagus cuniculus (Rabbit)
DescriptionGenome -assembly-
Sequence IDSEQ00001803
Sequence release2.0
External IDNone
Gene SPG00001805_2.0
Annotation
Prediction method(s) None
OrientationReverse
Toolbox Forward Reverse  
Sequence
>SEQ00001803_2.0 # Sequence # Iodothyronine deiodinase  (DIO) # Rabbit 
CAGGAGCTGGAGGCTCGGACTTTAATGCAGGAATTTGAGGGGAGCACTGTGTAGCCTCCT
AACACCTTGGCCCAGCTCCCCTTAAACACACTGGGACCTCGGCTTCCTCACCAGCTAAGT
GGGCTGGTGATCATATCCTGGAACGTCGGAGCACCCTAATCAAACACCCGGCAAAGCACT
GTCCGCACGGCCCCACAGCAGGTGGACGAGCAGGTGTCTGTCAGGGTGGACCAAGGTGTC
CCCCACACCAGGAGACACGGAGACGGCCCCACAGCAGGTGGACGAGCAGTGTCTGTCAGG
GTGGACCAAGGTGTCCCCCAACATCTGCCTCTGACCCCCTGTGCCAGTGCCACACCCTGG
ACTCCTGTCTCCACGGGCTCAGCAAAGACACCAGACGAGGGGCCAAGGCTCTTCTCAGAC
TTTGCTGCCAGGCCAGGGGCTCCTTTTTTCTGAACCCCAGCAGGGTCTGCAGTGCCCCCT
GCCGAGGACGCCCTTCCCGAGGGAGGCGCCTGCGCCATCCCTGTGAGCTCCCTTAATGTC
CCTCCCCCTCCCTGCTCAGGGCTGGACCATGATGGAGGTTGCTGGCCATGGTAAGGACAA
CGGCTGTCCACCGCCCCCATCCGGTGATCCCAGCATTCCTTGAGCTCAGAGGTGAGTTTC
CCTGGGTGGGAGGAGGGGCTCTGACACCCAGCACCCAGATTTTGCCAGGCACACATGAGT
ATTTGGGCACAGGGCAGGGCTCACACAGGGATGGCAGTTGGGTATGTGGGGTGAGAGGGG
CGATCACCAAACCCTGGGCAGGACCGGGTTGTGGGAAACCTACCCGGGAGGGCGCTCATT
CTTTTCTTTCTTTTTATTTTTTTTTGACAGGCAGAGTGGACAGTGAGAGAGAGAGAGACA
GAGAGAAAGGTCTTCCTTTTGCCATTGGTTCACCCTCCAATGGCTGCCGCGGCTGGCACA
CTGCGGCCGGCACATCGCTCTGATCTGAAGGCAGGAGCCAGGTGCTTCTCCTGGTCTCCC
ATGGGGTGCAGGGCCCAAGTACTTGGGCCATCCTCCACTGCACTCCCTGGCCACAGCAGA
GAGCTGGCCTGGAAGGGGGGCAACCGGGACAGAATCCGGCACCCCAACCGGGACTAGAAC
CCGGTGTGCTGGCGCCACAAGGCGGAGGATTAGCCTAGTGAGCCGCGGTGCCGGCTCGGG
AGGGCGCTCATTCTCCTCGGAGGCCAGGACACGTGGTGCCCACGAAGGTCCACAGGCCCC
ACCCTGGGTGAATAGCAGTGACAATAGGGGGTCCCTCAGGGGAGACAACACACAGGCACA
CACACACTGACACCCATACACCAACTCACACCCACACACCCACACACACTGACTCACACA
CATGGACAACACACTGGCATGCACACTCTGACACACCCCTGCACACCAGCTCACACGCAC
ATGGACAGCACACATGCACTGACTCACATACACACACACACTGACACAGGTGGACAACAC
ACACTGACACACGCTCACATGCCTGGACAACACGCTGGCATGCACACACTGGCACACATA
CACTGACACGTCCATGCACACCTCACACACTCACACATGAATCACTGAATCCAAAGTTGC
AGGAACCACAGTCCCCGGTGCCGTGCGTGCTGCAGCTTTGACAGCGCCCGTCCTGCTGGC
GTGGTGGGACTGCTGGACTTGGTGGGGTGAGATGGTTCCTGACCTCCTGGCCGGGTCCTG
ATTTGACTGAGGAATCATGCTTGGAATGAGGCTTGCACTCCTGTGTTTTTCTGTGTATTT
AAAACTTACATCAAGAATGGGTTTTGTATAATCTTGGTGTTTTTCACTTAAAAGGAGAGG
GAGCCTTGGGAAAATGCAAAACAACAGCAATCCAACCGACTTTGTGGAAGGCGGGGCAGT
AGAGCGGCAGGGCAGACGCATCTGACTGCCGGAGGTGTCTGGGCCTGCGTTCTCCAGGGC
AGGTGCCTCGTGGAGACACCGCCAGCCTCTGAGCGCGCCCAAGGCCGACAGGCCCCCCAA
GGTTGCTTTACCGACTCAGGACGAGGGGCGCCAGGGCAGCAACAAGGTAGTGGTGGTGCA
GAAGCGGAATCCCGCTCTTGTTTTAAAACGGGAAACGCAGGGGCACCGGGTTTCAGCGCA
CAGGCGGGAGGTGATGGCGGGCAGGTCTGCTCTCTCCTGGGGACCCGCCTCTGTTCCGCA
GTGACACCGCTGCGTTCTCAGCCAGGGCAGTGTTCAAGGAAGAAGAAAAGGCATTGGGAA
CGGGCCGAGAGAGCAAGGGAAAGACGAAGGAGGGAGGGGGCAGGGGAGGACAGAAAGGGG
CGGTGAGGGGGGGAAATGCTCTGATCTCCTGGAGCCTCCGGAGCCGCAGGTCCCCGCGCC
GCCGCGCTGAGCGCGCTTGAGACTTGTGGCCCGGGAAGCCGGAGGCAGCCCGGGTGCGCC
AGCTCCGCGGGAGGGGAGGCCGCCCGGCGCGCCCGGGGACAGCTCTGAGCGCGTTCGGGT
GCAGGGAGCAGCCGGAACCCGCTGGGCCTGGCCCGGCAGCGGCTCCCGCTGAACCCTGCC
GCTGCTTCCCCGCGCCACCAAGCCCGGACCGGGGCCGGCCGGCGGCGGAGAGCTCCAGGC
AGGCCCTGTCAGGCGTGGGCGCCGCCTTTCTCCGTGTTCTCCTGGGAGCTTGGTGATGAT
GAGACGGAGCGCGCAGGGCGCGGGCGCGGGGAAGAGACTCCGAAAACCACCTGTGCCAAT
TGTTTAAAAAGTTATGTTTCAACTTAAGTCCATTTAAAGGGAAAACCCCACAGTGTAGGG
TGTCCATTCCAAAAAGTCGTCAAGGGGGAGCGGCGTGCGGGCTGGGAGCAGAATGCGGGT
TGACACAGGCTAAACCGCCGCAAGCCGCGCCCCCAAGTGCACGCGCGCCCACCCCGCCCC
CGCCCCTAGCCGCCATGGCCCCCGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGCCGCCTCTGCGCTCCCA
GCCGGGGGAGGGGGATTTGAGCGAGCCAGCAGGTACCGGTGAGAGGCAGCCACAGCAGCA
GCCCCAGGGAACCGGGGCTTCCCTTGGCCGAGGGCGCAGTCTCAGTCCCTCCGGGTCACT
GGGGCCTCGCCAAGCTCAAGTTCCTCTGGCGCTTGCCCGTGAGCCTCGACGGCTCCGAGG
CCCAGCCCGCCCCGTCCGGCCAGTTGTCCCTCGGTCGCTTACACCCGCCGGGGCCGGGCG
CCACGCAGCTGCTGGTCGTAGCGCCGCAGCCAAGCGCGCAGCTCCGAGACCTGGTAGCCG
TCGGGGCCTCGGCCGCCCTGGTACATGATGGTGCCACTCTGGATGACGTAGAGGCGCTCG
AAGTAGGCGCCGTAGGCCGAGCTGCTGGAGTTGGCCATGGTGTCCAGCACCAGGGCGCAG
CCCGGCGCGCCTTGCTGCAGCACCCTGGCCGCCCTGACCCGGTCCTCCAGGCTGCGGTGC
TGCGGGATGACGTAGGGGGAGTCAGTGGTGACCCAGCCGTCGGAGGGGTGCGCCTCCTCA
ATGTAGATGATGAGGAAGTCGACGTCGCGCTGGTACTTGGCGACCAGGCGTCCGGAAGGC
GCTTCATGCGCGCCATGAACGGCGGTTCAGGTGCAGCTGCCCGAAGGTTGAGCACCAACG
GGCGGTTTCCCTGGGCGTAGTCGAGGATGCGCTGGCTTTGGAAAGCCGTCGGGCAGAACC
ACCTCGGAGTTGGGCGCCGGGGCCGCCCTCGTGCGCCTGCTTGAAGAAATCCAGCTGCTG
GCCCGTGCCACACGGCCCGGAGCGACGCCAGCGTGCACAGGCGGTTGTCGTCCGACACGC
AGATGGGCGGGTCATCGGGGGACACCTCCTCGCCGTCGCTGTTGAGCTCCACCTCGGGCT
CGGGCTGCCCCCGGCGGCGGCGGCGGCCCAGGATGTGCTTGCGGATGCACAGGAAGTCGA
GGAGCCACAGCATGAAAGCCGTGCCCAGGAAGCGCGGGAAGAGCACGAGGCACGAGGCGG
TCTGGGCGCAGAGCCGCAGGGAGTGAAGCAGCAGGGAGCGGAGCATGGTGGCCGCAGGCC
CCGACGCCCCCTGGGCCCTGTCGCCTTCCCCGACCACCAGCCGCGAGGCGGCCTGGCGAG
GCATCTGGGTTCTGGCCGTGCCGAGAGCTCGATTTATAGCCTTCAATTGGCGGGAGACTC
CACCTCTGGCCCGGGCCCGCCCCCTTGCAACTTGAGCTCAGAGGGATCACACTGCGGCGC
CTCTCATGCCTTATGAACCGCGCGGTCGACGGTGCTCACTGGCCTGAATAACAGGGAAGG
GTCGCCGGGTGCCCGTGCTCTAGAACCGGATGGGGCACCGGAGTTCGAGCCCTGGGGGGA
CTTACTCTGGGCAGAACTGATGCACGTCCAGGCAGTGCGGAGAGTACCCAGACTAAGGGA
TCTTCCCGTGCTCTCCCATACGACACCGAGAAAAGCTCATCTCTCCTGCCGGAGGATTGG
CTCCTTGCCTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGACGTTGCTCTCTGCCCCG
GGAGCGTCGAGACTGGAGCGCCCGAGCTGAGCCCACTCGCGGAGCCGGAGGGCGGCGGCC
CGACTCACCGCGGAGGCGCCCGAACGCGTCAAGTGCGTACTTTCCACCGAGAGCGTGTGC
CGCGGCGTTTAGGGGTGCGGGGCAACTCCCCAACTCTGCGGAGCCCTGGGCGGCCCCGCC
GCCGCGTCCGAGACCTTCTGGCCCCGCGCGGCGCGCGGCGCGGGGCGGGCGACTTGTGCT
CCGGGGCGGGGAGGTGCCTTGACCCGGGGTCCCCGAGGCCAGGAGCAAGCCCCCTTCTCC
TCGGCCCGCCGAGTCCCGCGGGGCAAGCCCGAGCCGAGTGGCGCGCGGTCTGCCCCTCGG
CTGGGGAGCCGCGCTGCCCGGAGAGCCCTTGCGGTGGCGGGCGCTTGTCCGGGGCTGCGG
GGCCCGAGCCCGCCGCCGCCTCCGCCGCTGCCTCCCGCGTCCCGTGCGCCGCCCGCCCCG
GGGACCGGCCGCCCAACAACTTCTCGGGACCAAGACAGCGCTCGCGCCCTGGACCGAGAT
GGGAGCTGGCCGAGCCCTACGGAACGCGGGCGGATCGCTTTGGGCGGCCGGAGAACGCGC
CGGGAGAAGTCGACCGCAGGCCAGTTGTCCCGGGGGTGCGCAGGTACTCACCCCGCCCTG
GGCGAGGGTCCTCCCCTCTGTTTTTCTCGGACCTGGCAGGACCCTCGGCCCCCTGAGCTC
CCTGCCAGACCCGTGGCTCCGGGAGGTCAAGCCCCTCAGTGTGCGGGGCGGTGGGAGGGG
TGTGTGAGGGTGTCCCCGCCGCCTGGGGCAGGGGGCGCCCCCAGGAACCTCCCATCTAGG
GCAAGGCAGCTTGAGCTCTCCCACTCTGAGCCCCCAAACTGCGCCTCACCACTCTGGGTA
GGGGTCTTCTGGTGGGCTGGGGGATGCTCCCTGAGCCCTGGGGTGGGGTGGGAAGGTGGG
GGTCTCATTAGTCTGCCCCAGCCCCTCCCCCTCCCCCGCAAGAGGAACACTGCTGAGCTA
GCAGCTCTGTCCTTTCTGGGGGAGGAAGACAGCGTAGGAGGAGAAGCCTGTAGTGGGGGG
GCTCTGAGAGGAGGGCTGGGGTTTCCCAAGGCGCCGGGCGCTGGGCAGGGGCTGGAGGGT
GGTGGGAGGCCCACCTCTGGTTGGACAATCTTGGTTCCTGGGATGTGCCTGTCTAGGGCC
TAGAGCATCAGGGACATGGGACAGTGCGCCAATCCCCTTTCTCACATTTAGTCTCAGAGA
AAACCACCCTGGGCTGGGAGAGTATTTCTGTTCCTTCTGGGATTGGTGGTATGTGTGTGT
GCACATGCATGTGCAATCATGAATGTACACGGGCATGTACATGAATGTATACGTGTGTGC
ATGCAAGTACACGGGCATGTATGCATGCATGCATGGGCATATGTACCTGTGTGCACATAT
GTGTGCATGATTGTACATGGGGCATGCATGCGTGTGTACATGGGCATATGAATCTGCACA
CACATGTGTGCATGCATGTACATGGGGGCATGCATGCACGCACATGTGCATGGGCATATG
CACACGCACACATGTGTGCATGCATGCACATGGGGCGTGTATGCATGCATGTGTGCTTAT
GTGCATATACACACGTGTGTGCATGTGCACATGTGTGCATGTGTGTACGTGGGGCATGCA
TGCATGCATGTGTGCATGCACCTGCGTGTATGTGCACAATGTGTGTACATGGGGCATGTA
TGTGTGCATGCATGTGTGCATGCATGTGTGCATGTGTGTATGTGCACAATGTGTGTACAT
GGGGCATGTATGTGTGCATGCACCTGCATGTATGTGCACAATGTGTGTACATGGGGCATG
TATGTGTGCATGCATGTGTGCATGCGTGTATGTGCACAATGTGTGTACATGGGGCATGTA
TGTGTGCATGCATGCATGTGTGCATGTGTGTATGTGCACAATGTGTGTACATGGGGCATG
TATGTGTGCATGCACCTGCATGTATGTGCACAATGTGTGTACATGGGGCATGTATGTGTG
CATGCATGTGTGCATGTGTGTACGCACCTGTGTGTGCACGTGCACATGTGTGTATGGCAT
GGTCCAGGGCAGGCGTAAGGCCAGCCCTCTGGTCCCCTCTGTAGGATCAGCCCTTCCAGC
GGCACCAGGTGACTCCTTCCAGGCCCACGGACACAGCAGCGCCCTGGTCCTGAAGGCCGC
CACCTGCTCTGGCATCTGCTGTTTCTTGGGTGGGCAGGCTGCGCTCCACACCTCAGGGTC
CCAGGCCCATCTGGCCCGCACAACCTCTTCTGCAGGTGAGGACAGGTTCAAGGTCCAGTC
TCCGGGTCACCTGGCCCAGTGGTGACTCCCACTTCAGGGCTCTTCTCCCCCACTCCGGCC
CCTCTCTCTCATCACCCTCTGCTAGACCCTCCCTCATCCTGGGCAGCCCTCAGCTTGACT
AGACCCGGCCCTTCTGACCAGTCCTGTCCTGTCCTGTCCCAGCCGTCAGGAGCGAGGGGA
CTGCTCCCAGGCCAAGACCCACCTGGGACCTGGGGCAGATCCAGGCCCAGTGCGCCTGGC
AGGCTCCGCTGTTGGGGGTGGGGGTGGGGACCAGGGCTGGAGCTGGGGCCGCTCCCTGTG
CCTCCCCTCCCGCTCTGCCTGCCCTCTCCCAGCTCCAGCAGGGGGCGGGCAGGGGAAAGA
AAAGCAGGTTGAACTGGGTCCACTCGGTATCTAGCCACTTGGAGGGAGGCTAGGGGTGGT
GGGGAGGAGGCGGAGGCCTGGCACCGAGGGAGAATTGGCCTTTGGATGGCCTCCTGTTCC
CCAGACACGGGGTGGGCGTGCGTGGCCATGGCCGCTGGGTCCTTTCTCCATGCAGGGCCA
CCTCCTCAGACTTCGGGGACAGGTGGTCCAGCCTGCTCACCGGGAGGACTGTTGGAGAAC
TACA
Chart Advanced