SelenoDB
Release 2.0
Chart Advanced
Sequence Report for SEQ00001625_2.0
Identity
SequenceGlutathione peroxidase (GPx)
SpeciesOchotona princeps (Pika)
DescriptionGenome -assembly-
Sequence IDSEQ00001625
Sequence release2.0
External IDNone
Gene SPG00001627_2.0
Annotation
Prediction method(s) None
OrientationForward
Toolbox
Sequence
>SEQ00001625_2.0 # Sequence # Glutathione peroxidase (GPx) # Pika 
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
TCATGGGTCTCTTAGCTCCCAATTTAGTGCTTGGATTATGACTTTTGATTCCATAGAAAT
AGTCTATAAAAATCAGTGGTTGGCTGCAGCTGCAGGAAAGTTGAGTGTACATCAGGGAAA
ATACAGACTGCAGGGCTTGGGAGCTATTCCTATCTGTAAGTTAAATGGAGTATAGGACAA
GTCAGGGTCATAGATTTTACTGTTTGTCTTTGATTTTAGGTGCATTTGCCATTCATAACT
ACAGTATTTGTAATTGTGCTTAAACAAAATTCTCCTGGGTCTGGACCTAGTGTGGTAACC
TAGTGGCTGAAGTCCTTGCCTTGCATATGCCAAGATCCCATATGGGCACCAGTTTGTGCC
CCAGCTGTTCCACTTCCCATCCAGCTCCCTGTTTGTGGCCTGGGAAAGCAGTTGAGGTTG
GCTCAAAACCTTGGGACCCTGCACCTGCATGGGAGATCTGGTAGAAGTTCCTGGCTCCTG
GCTTTGGATGAGCTCAGCTCTGGCCATTGCAGCCGCTTGGGATGTGAATCAACATATGAA
AGATCTTTGTCTCTCCTCTCGGTAAATACAATTTTCCAATAAAAATACCAAAGCAATTAG
AAACAAATTATTTTTGTAAATAACTTTGTATTTAGCAGTACAATGAAAATGAACTTTTTC
ATGGTTAACAAAATGAAACACATTACTAGTTGGAAGCTAAGAATCATTTGGCTAGCCCTC
TAAAAAGACCCAGCAGAAAACAAGCAGCAGCTCATAGCCAGCCCTGGGTAAACTTACTGA
TGTGGGAGCCAAGAGTGCCAGGTTAGCATCTCACAGCGATCAGCCCAACATACAGTCTAA
CGCACATCATTTGAACAAAGAATAGTCTGAAGTTCATCAAAGGTCCGTTTTAGAGTTTTA
AATTTGAGTTAGCCAATTTGTAAAAATATAGCACAGTATTGGTAGGTGCATGCTCAAGGT
TGCACAACACATCTGCAGAATTTACTCATCGTACATAGCTGAAATTTCCTGCTCATCGAA
CAACTCTGCGTTTGCCTTGGCCTTCAGCCCCGGGTGATCACCATTCTACTTACTGCTCTG
TGAGTTTCACTGTTTTGGATACTTCGTGTAGTAGATATCATAAGTACTGTTCTTCTGATA
CTGACTTGTTTTACATAGTATATTGTCCTCAGGGTTGATCCGTGTTGTCACAAATTGCAG
GATTTTCTCCTGCTGTTCAAAACCTGAATAATATGTTGCTGTGTGAGCATTACCACAGTT
CCTTTCTCTGTTCCTCAGCACACAGACATTGAAGTAATTTCCATGTCATGACTGTTGACA
GTCATGCTGCTGATAGTTCTTGTGGTATGTGGACAATTATAAACACCAGTGGTCATCATG
ATCCAAGTGATTTTAGGTAGAATTTTTTTGCTTTGTCTTGAGATACATTAATTGTCTTAA
TTCATTTGTTTTTAGTGGGCTCAATAGCACCATTTAAAAAAATCATTTGTATTTCCTAAG
GTAAAGACAAATTAATATTGGCCAATAAGTGGTTTTCTAAATTTGTGTGACTTAAAAAAG
AAAGTGTTACTCTCTTTTTGGTGAAAAAGCACTTAAGAACAGATTCTGTTTTAAAATCCA
TGCTTGATTTTGTTGAAAATGGAAGTACTTATGGAACAAGCTATTGCTTGTGGATGGCTC
TTTTAACACGATAGTAGTCTACTGTTAAAACTAAGCTCTCTTAGGACTGGCATTATGGCA
TAGTGGGTAAAGCCACCAACTGCAGTGCTGATGCCAACATCCATATCGGTGCTGCTGGTT
CAAGTCGTGGCTGCTCCATTTGGGAAAAGCAGAGCAATCTACCCAATGGGAGACTCAGAT
GAAGCTACCCCATTTCAGATCCAGATCCCTGCTAATGACTTGGGGAATAATGGAAGGTGG
CTCCATTTGGGCTCCTGTACCTATGTGGGAGAAACAGAAAAAGTTTTAAGCTCCTGGCTT
CGGCCTGACTCAGCTTTCACTGTTGTGGCTATCTGGAAAGTAAACCAGTAGAGAGAATAT
CTCTGTTTCTCCTTCTTTCTCTGTAACTTTGCCTTTCAAATACATTTTTTAAAAACTTAA
AAATACAGCTTTATAAAGTGCTAAGAATAAATGTATTGTTCTTCCATGGTATTATAGCAC
CTTCAAAATCCAGTGCAGCTATATCCTTTTCCAGGAGATCAGACCTTATTTCTTAGCCCT
AGGGTAATTCTCTTTTGGACTACAGTTTCGTTATATATTTTTATACCTCTTGTAGGTCTA
AATTGGGCCTTCAAATATAAATATTTGTATTTATTTCCCCTACTAAAATGTAAGCACCTT
AGGGTATTAACTGTTAAACACACAGATAAACACACCAGATCAATTGTTGAATATCTGCTT
TATCCAGAGTACTGTATTATAAACTATGGAAGCATGGCTGACAACATTTTATTCCTCCTA
GTGCCTAGCCTTCCTCTTTTTGTCTTTTAAATTTTTACTTGTTATTTGCTTTTATTTAAA
TGTCTGATCTTTCATCTGCTGGTTCAATCCTCAAATGCTGTGAAAACACAGGTGTGGCCT
GTGCCAGGGGGAGGCAGAACCCAGGAGCCCCGTGCAGATTTCCCATGTGGGTGGCAAGGA
CATAAGTACTTGGGTCATTGCTTGCTTGGTCTCAGGCTGCACACTAACAGGAAGCGAGAA
TCTGAAGGAGAGCTGGGATTCCAAACCTAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNTGCCACTACTTCACAGTGCATCTTTCCTGTTCCCTTAATAACCTTTGAA
ATACTGTAGATATTTGAGGCTTAGTGTACACCCCTCCTGTTTGGTCTCATACATCTAAAA
TGTCACCTTAAAGTCATTGTCTCTCATTATTCTATCTCTAGTTCAGATATTTCTTCTGAA
CAAGACCTTGCTTCAATTGCTTTTGAATTCCCTGTGCATCAGAAAGTCCCGAATCTTTCT
CTCCAAATGTGTTTTTACTTTCTGGGAAACATTTTCACCCACCTAGCTGGCAAAGCAAAA
ATCTTAAAAGGGATCTTTGGTGCATGTTCAGTCAGGCCTTCCACATTGAGCTCCTTACCA
CGTTTGGTTGATTCTGCCTCCGAAATGTACCCCCCCCGGACTCTGCTCCCTAGGGCACGT
TCCCATATGCCGGCCCATGTAGGGGCATAATTGGCGCCTTGGGCTTACCACACAGTCATC
ACAGAATCCATGTAAAATTACAGAATATGTCTTGCCTTACAATTCCTCCTTGATTCTCAC
TATTGGTAGGACAGGATTCAGAAATCCTCACCCGTGACTTCAAGACTGTCCCCTCAGGGC
TTCTCCAGTCCTGCCTCATACCATTCCTTCCCTTCTGTAATATGTTAACGGTAGCATTCA
TTAAATTCCAGAGATTTGCTGAGAGTTTTTGAAGACAACTTCACCAGAAGAAGTGCCACT
AACCCTCCCTGTCAGTGTACACCTCATTTCCTTCAATAAGCTTTCCCCATACCCCTCACT
CTAAATTAAGGCCCACTTCCCGTTGTCTGTCTCCGAGTGTCCTGAACTCCTCCTTATAGA
AAATAATAGCTGGTGTGGTGTGGTGTGTGTAGTATCTGGCTTTCCACTGTTCTGTCAGAA
CCACAAAGAGCAGGGGTCATTGCCTCTTTTCCTCACAATGCAAGCCCAGGACTAGAACAC
AGTGGAGAGTCAACAGACACTTGAAGGAAGATTAAAATAAATAGAAGATAAAAATTGAAG
AAGATAAAAATTGAAGAAGAAAATAAATAGAGGATAAAAATTGAAATACTGTATTACAGA
ATGTGTGAAAACTTAAGGCTCTAACTTGACATATGAAGTAGGTTATTGCTACTCATGATG
ACCATAGTGCATGGTTAAAGCAGAGTGCTGCTTTTCTGATATGGCCAATTTCAGTATTGT
TGTGTATATATATGTATGTATGTATGTATATACACATGTATATACATATATATACACATA
TATACTCTGTGTGTGTTTGGTGCAACGATGTGGCCTGGAACTTTGAGAAGTTTCTCATGG
GTCCCAACGGCATCCCTCTGCGCAGGTATAGCTGCCAGTTTCCCACCATCGACATCATGC
CCAGCATCGCAGCCCTGCTGGCCCAGAAGTCCTGTGGCGCCTAGGCCTTGCCCACTTCCT
GGCTGTTGGGCAGTGGCCCACTGCTGTATGGGAGTTTCATCCATGAGTGCATTTCTCCTA
AAATGTGCATGGAGGAACAGAAAAACAACAGAAAAAAAATGTATTAATCACTTGCTGTTG
GGTCCTGCTCCAGACGAATGGGCTGCATAATGAGCTTCCTTTCCATGGGAGACAGCCGGT
ACACAAGAACACAGAGAACCTGGGGTCTTGAAAACTACTGCCATCTGCAGAAAACAGTAA
CAGTACAGGGAGGGTCACTACAGCGAGACTGTCTGAGCTGACAGGCAGATGAGAAGGAGT
CAGTTTCAGTTAGGACCTGTGGGAAGAACTTTCCAGGAAGAGGAACAGAAAATACCAAAG
TACTGAGGCAGGCATCAGCTGGGACACCCAAGAACGGGGCTGTGGCCAGGAAAGCACTGG
ATAAAAAGCAAAGAGCACAGGCTTCTAGAATTAAGGGTTCCATGGCTGGAAGCTCTGACT
GCTCCCCCTCCTTATTGGCTGTGCATCACGAATTGGAGACACTGACGATGTCCAGCACAT
TGGGATTTTGCAAATAAAAGTATAAACTGTAAAAAAATAGTCATCATAAACACCATTAAT
AATCTAGACATAATTCATGGATATTCCATAGGATTTATGTGATGGAAAAACTGGCCAGCT
ATTTACATTAATGGATTATATTTATCTGTTTACTAATTTCTTTTTTTTTTAAAGATTTAT
TTATTTTTATTACAAAGTCAGATATACAGAGAGGAGGAGAGACAGAGAGGAAGATCTTCC
GTCCGATGATTCACTCCTCAAGTGAGCCGCAACGGGCCGGTGCTGTGCCAATCTGATGCC
GGGAACCTGGAACCTCTTCCTCCAGGTCTCCCACGCGGATGCAGGGTCCCAAAGCTTTGG
ACCATCCTCAACTGCTTTCCCAGGGCACAAGCAGGGAGCTGGATGGGAAGTGGAGCTGCC
GGGATCAGAACCGGTGCCCATATGGGATCCCGGGGCGTTCAAGGCAAGGACTTTGGCCGC
TAGGCCACGCCGCCGGGCCCTGTTTACTAATTTCTTATAAACAAGTGTGTTATATTGCAA
TTTACAAACATTAACATTTCCATTGATTTCTTATAAAAGGTGAAAAAGCTGAAGAGAGAA
CTCTCACAGATGAAGCAAGAACTGCTCTATAAAGAACAAGGCTTTGAAACATTACAACAG
TGAGTATAAAAATACTGAAATTGACTTTAGAATGAGTAAAATTTCCATAGCAAATAAAAG
AAAATGGAAGTATAGGTGTATAAGAGAGTTCTCAAAGAAACAAAGTAAAAAACTCAAAAT
TCTGCATCAGAAATTAAAAACAAAAATGTCAACCAACCAACATATAAAAAATTGGGAAAA
TCCTATACACTTTTGAAAAAGTTTGAAGTATTAATCGTTGGAGATCCAAAGAAAATAAAA
ATCGTGCTGCTCTCTCCTGGATCCCTGGCCAGCTTCCTTTAAGATGGGGAGTGGCATGGG
GAGTGTCACTTCACATTCTACCCCAGAGACAGGGTTAGGTGGATGGACTTGACTCCTGTG
TGAGCCCGCAGCTGCCCTAAACCCTTGAGTGGAGGCCTCAGTCTACCCCTCTGTCAGTCA
AGGCACTGTCCAACCTGGGCTGGGCTGAGCTCAGGGGCGTAAGAACAAGGCAGATGTTGG
TGAAGGGGCAGCAGCATACTCTTTGTCCTGTCCAAGTTGGTACTGAAATCTTTGGGTCAG
CAGCATAGTGTCCGGGTGGGTTAGGTAAAATGCAGTCTGCCAAGGGGAGCTGAGCCTCTG
GAAGGTCCTGGTCTCCCTGCTGGTCGGGCATGGACATAAAATGGTGAGACACACAGAGGC
TTCCCTTTCTCACAGGGCCTCTCATAGGGGACAGGAAGTCTCAGGCCTTCACAGCCTCAT
GCCCGCCAGAGCACCAGAGGTGGCCCTCCCCAGAAGCTCTAAACTGCTTTGTGTCCCTCC
CATGATAAGGGCATTGGTGCCACAGCCCAGGATTCTCAGGGGTTTCCCTGGTCAGTTTCA
TGTTCATGTAGACCTGGTTCTTTCCCCCAGTAACACCTCAGAGATGCGAAACAGGTCTCA
GAAGCCGACTCTGGCAACACCACCCAGCTCCATCCTTCTTCCCATGCAAGCCTGTTCTGC
CTTCTGCTGTTAGGAAATCTGGGACAATTCAAGGCAACAGACCTTACCTCATTCAAGCTT
TTGGGTGTCGCTGGCTGGGTACAGCCAAGCTGCACGCAGTTGTGTGGCTGGACACCTCTG
GGGATACCTGGTCACTGCTGCTGACCGCCCCACCCCCAGCCAGCCAGGTACCCAGTTTCA
GATCCTCAGCCTGCCTTTTTGGTTTACTGCCCCGTGTGATCATCACCCCGATACTCTTAT
AGGTGTTCCTCTTCTAGGCATTTTCAAACCTGACTTCCTATGAGAGCAATTTGGGAGAGC
TTTTAAAAATCACTGCCCCTGCTCTCCACTGGGTATGTCTTAGGAGATCACAGGTGATTC
TCAAAGTGTTCTAAGAAACTGCTGCTTACAGAGTTCTCCTAATTCCCACCCAGACCTAGA
GTGATCTAAATATGTTATTTAGTAACTGGGTATCAACAAAAAGCAGGGCTTTGAGGTGGG
GGGTAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNCAGAGAAGGAATGCAGATGAAATTCTCTCCTCTTTTAGAAAAGATTTAG
CTGCAGAGTATGAATTCGATCACGCCAAATGCTTTTTTTTTCTTCCTTAAAGTTTTCTTC
ATTTTACAACAGCCAGATATACACAGAGGAGGAGAGACAGAGAGGAAGATCTTCCGTCCG
ATGATTCACTCAACAAGTGAGCCGCAATGGGCCAATGCGCGCTGATCCGAAGCCGGGAAC
CTGGAACCTCTTCCGGGTCTCCCACGCGGGTGCAGGGTCCCAATGCATTGGGCCGTCCTC
AGCTGCTTTCCCAGGCCCCAAGCAGGGAGCTGGATGGGAAGTGGAGCTGCCGGGATTAGA
ACCAGCGCCCATATGGGATCCCGGTGTGCTCAAGGCGAGGACTTTAGCCGCTAGGCCACG
CCGCCGGGCCCGCCAAAAGCTATTTTCAAAATGTTTAAAGAAAAAAGGGTACTTTTCAGA
TTAAGAACAAAAAACAATAGTTGATTTTAAAAGGTAACAGATAATGCCCGTATTTTATTT
TATGTCAAAAGAGAGAAAAAGTATGAAATGGAAAAAAGAAGAAGAATGGAAAGAAAGGAA
AAGAGAGATGTTTATAGTAGAGAGACAAAGAGGCAGGAGGGTGGGGTCCAGGGAGGGGGC
TCCCTGTCCAGGGCTGCACTGCGATAGTTTGTTTCTCCTATTTAGCCTTCTTTAGAGCAG
TGGAGACCCCAGACATTTTCATGTTTTTAAAACCTTCTGAAAGCTAAACTTGTTATCGTT
ACATGTTAAAATATATTTCTGAGAAGTTAACTTGATTTTATTTTCAAATGATAAAAGTTC
ATTTCTATACTAAAAGTTTGTTTCACATTAAATTCTAAATAATTTAGATATCAAGAATTG
AAATACTAGTAAAATATTATAGGGCTTAAATTTGCATAAACTTTCCAGTGTTGGATTCAT
GTAGAAAAAAATACAATCAGGGATCTCATGTTCCTTATCCCAAACACCTTTTGTGTTATG
CATGTGTGTGGTTTAAAAATCCTGGGACTTCATTGATTTTTATATGATATAACCAAATTT
ATTTCCCTAATTTCTTTTAAGATTTTAATTGTTCAATGGGGAAAAGGTTAATGTTTATTA
AAACAGTATTTGGGGAAATATGAGTATGTCATCTACAAACCGTACTTAATTTGCATATGT
TTGGAAGACAGATAAGAAAGGCTTTTCTTCAGATTACAGCTTTTGCATTGAAAATAAATA
CTAATTCTTAAATATTTAAGTCCACTGGCTCCAAGTCCATTCTCTCTGTTCCCTCAGGTA
GCCTTTCTCTGGTGAGTCAATGGGTAAGGCCAACAGCAGGCCTGAAGAGCTGGAGAGCTG
CTGATTGGCAGGGCAGAGACACAACCCTGGGTACCACAAGTAAACCCCA
Chart Advanced