SelenoDB
Release 2.0
Chart Advanced
Sequence Report for SEQ00001467_2.0
Identity
SequenceSelenoprotein K (SELENOK)
SpeciesMus musculus (Mouse)
DescriptionGenome -assembly-
Sequence IDSEQ00001467
Sequence release2.0
External IDNone
Gene SPG00001468_2.0
Annotation
Prediction method(s) None
OrientationForward
Toolbox
Sequence
>SEQ00001467_2.0 # Sequence # Selenoprotein K (SELENOK) # Mouse 
TGTTCCACCTATAGCGTTGCAGATCCCTTTAGCTCCTTGGGTACTTTCTCTAGCTCCTCC
ATTGGGAGCCCTGTGATCCATCCATTAGCTGACTGTGAGCATCCACTACTGTGTTTGCTA
GGCCCCGGCATAATCTCACAAGAGACAGCTACATCTGGGTCCATTCGAAAAAATCTTGCT
AGTGTATGCAATGGTGTCAGCATTTGGATGCTGATTATGGGGTGGATCCCTGGATATGGC
AGTCTCTACATGGTCCATCCTTTCATCTCAGCTCCAAACTTTGTCTCTGTAACTCCTTCC
ATGGGTGTTTTGTTCCCACTTCTAAGGAGGGGCATAGTGTCCACACTTCAGTCTTCATTT
TTCTTGAGTTTCATGTGTTTAGGAAATTGTATCTTATATCTTGGGTATCCTAGGTTTTGG
GCTAATATCCACTTATCAGTGAGTACATATTGTGTGAGTTCCTTTGTGAATGTGTTACCT
CACTCAGGATGATGCCCTCCAGGTCCATCCATTTGGCTAGGAATTTCATGAATTCATTCT
TTTTAATAGCTGAGTAGTACTCCATTGTGTAGATGTACCACATTTTCTGTATCCATTCCT
CTGTTGAGGGGCATCTAGGTCCTTTCCAGCTTCTGGCTATTATAAATAAGGCTGCTATGA
ACATAGTGGAGCATGTGTCCTTCTTACCAGTTGGGGCATCTTCTGGATATATGCCCAGGA
GAGGTATTGCTGGATCCTCCAGTAGTACTATGTCCAATTTTCTGAGGAACCGCCAGACTG
ATTTCCAGAGTGGTTGTACAAGCCTGCAATCCCACCAACAATGGAGGAGTGTTCCTCTTT
CTCCACATCCACGCCAGCACCTGCTGTCACCTGAATTTTTGATCTTAGCCATTCTGACTG
GTGTGAGGTGGAATCTCAGGGTTGTTTTGATTTGCATTTCCCTGATGATTAAGGATGTTG
AACATTTTTTCAGGTGCTTCTCTGCCATTCGGTATTCCTCAGGTGAGAATTCTTTGTTCA
GTTCTGAGCCCCATTTTTTAATGGGGTTATTTGATTTTCTGAAGTCCACCTTTTTGAGTT
TTTTATACATTGGATATTAGTCCCCTATCTGATTTAGGATAGGTAAAGATCCTTTCCCAA
TCTGTTGGTGGTCTTTTTGTCTTATTGACGGTGTCTTTTGCCTTGCAGAAACTTTGGAGT
TTCATTAGGTCCCATTTGTCAATTCTCGCTCTTACAGCACAAGCCATTGCTGTTCTGTTC
AGGAAATTTTCCCCTGTGCCCATATCTTCAAGGCTTTTCCCCACTTTCTCCTCTATAAGT
TTCAGTGTCTCTGGTTTTATGTGAAGTTCCTTGATCCACTTAGATTTGACCTTAGTACAA
GGAGATAAGTATGGATCGATTCGCATTCTTCTACATGATAACAACCAGTTTTGCCAGCAC
CAATTGTTGAAAATGTTGTCTTTCTTCCACTGGATGGTTTTAGCTCCCTTGTCGAAGATC
AAGTGACCATAGGTGTGTGGGTTCATTTCTGGGTCTTCAATTCTGTTCCATTGGTCTACT
TGTCTGTCTCTATACCAGTACCATGCAGTTTTTATCACAATTGCTCTGTAGTAAAGCTTT
AGGTCAGGCATGGTGATTCCACCAGAGGTTCTTTTATCCTTGAGAAGAGTTTTTGCTATC
CTAGGTTTTTTGTTATTCCAGATGAATTTGCAAATTGCTCCTTCTAATTCGTTGAAGAAC
TGAGTTGGAATTTTGATGGGGATTGCATTGAATCTTTATTGTTTTATTTTAAAGCATATT
CTTACTATGAACCCCTGGATGGCTTGGAACTGTACTATCTGTTCTAGGACATCAGAGAAT
TCTGCCCACCTTGCCTCTAGATTACCAGCATTATAGGTGGGCATGTCACAGCTAGATAAA
TCAGTCCTTTTAAGTGGCTTAATAAGGATGAGTGGCTGAATCTCTCTGGTTAGGGTGGCT
AGGACATAGTCTGTGGTCTTAGCTCTACTAACAGAAGTCAATCATGAAATGCAGCCCTCC
TGCCTTTAACTCCACTGTCTTTCAAATTAAGAGCACTATTGTTTTGCTTTATCATAACAT
CTGTTATAAGTCACCAAAGGACTAGGGCAGATTCTGTCCTTATTCTATAGATGGTGAAAC
TGAGCCTTCGAGTGTTAAGTCAATACTGAATAGATATGTGGAACTTCTCTTCTTACTCAT
GATGTGTTTCCAATGACTTAATCAATGAAATAAAAGCAACCTCAGCCAGACATGATGGCC
CAGGCCTGTAATCACAGTGCTTGAAAAGTGGAGACAGAAAGGGACAGGATAAAAGAGCTG
ATAAAGTTCCCTCATTTGACAGTACCTAATATTATCAATGAACACTGAGGTAATCATTTT
TAGATGCTTGATAAGTATCCTGCTGGTCCATTTTTGGGTTCAACACCAGGCATTCAAGAA
ACTGCATAAAAATTGAATTTACTGAAAAATCAAATTACCGTAGTTATACTAGTCCTAACA
AAAATAGTATCTAGGTACTGATTGTGGTTGTGCCTAATAAGACAAGTTTTTTTTTTTTTT
TTCAAGTTTTAAGATGATCCTCCTGAGAGACTAGGCCTGAGTAATACTTGGTGTGCTCTA
ATACACTTCCCTCCTCTCTGGAGCACATAATCATCAAGCCTTTTCCACTTTTAAAACTAT
ATTTTTCCATTATACTTACAGCATTCCCACCATCTCTCTTCTGTCTCTGAATTTCTTCAT
AGACAATTTATTGTTTTTCATGAGGGATATTTTCCTTGAACAATAGTTACTGTTTGAATG
TGACCTATGATTTCCTGCAGGACTTCTCAACTATGAAGCAAATTGATGGATGAACAGGAA
TATAGGTGTGGAATAGAATGTACACATGATGTACCCTGTTCCTTGATTGAAGAGGAAGAC
ATGCTCTGGGAGACTGCAAGAATTTCTTCATAACTACAAAGTTTCCAAACTCAGTCCATG
TCTACCCCTATTGTGGCTGTGCAGAGCTCAATGGGCCTGTGCTGTCTGAATCCTTTCATC
TCTCATCATCCAGTAGCTGTGCTGCTATTGTCCTGAGACCCAGCTGGGTGACCCTAGATA
GTGATGGACTCTGGGCAGAGCTATCAATCAATAGCAACAGTAGGAGGAACCTTGTGGGAT
CCTTCTAGGATTCTCCATTGATGTAGCACTAGTGAGCTGTGGGGTAGACAACAAGCAATT
CTCTACTGAGTGTGGCAGCCACTGTTCAGAACAGTAGGACAAGAGGAGCAGCTTTTAAAG
GAACTGCAAGCACATAATGGAGTTGGCCTAAAAGTGAGACTATGTGTGCTTCAGAGACAG
AGGTGGAAGACTAGGGATGCCTAAGTATATTGTAGTCAGGCCATTTCATTATCTGAAGAA
GCTGAAAAATAAGCTTCATGATATTATATTTTTCTGCTGGATTTGGCATTGCTTTGGTCT
GTTCCATCGTCGATATGCTTTGATTCTCTGTGGAATAATATTGTTTATTCTTAGCATTGT
ATGTTGGAAACATAACACTCTCATTGATGGTCCTGGAAGAGTGTGGTTGGGTAAGAGACA
GAATTCACTCTCTAGGCATTGAAGCAAGATGTGGCGTTTAAATGGGAATGTTGCCCTTTG
CTCCTATGTTGCATACTTATTTTCCAGTACCTGGAAGTCTTTCAGAGGAGTAGGGGAAAA
GTATAGGATAATCATTGTGGAGAATTTGGGTGACAGCTACCTCTATATCTAAGGTGGGAG
AGGTTTACCACCACAAAAAGCAAAAAGCTCACTTGCAGCTTTTGGATTCAAGGTAGGTAC
TTTATCTACTTCATAGAGAAGAGGTCCTATCTTATTTTCATCCTAATCTGTCATTTGTGC
TCCCCAAGTCCTATTGCTTATTAAAGAGGGGAACTCTTAAGTAGGAGAATTAGCCCCAGG
CAACGAGTTCCCTGTTTGGCTAATCAATGCAAGTCAGTCAGTCCTTGAATCATACACATA
ACCAATAAAAATGCAGTCAGCAAGTTTTATTTATGTATTTGAGTCTTCATAGTCACACAT
GTATGTAACAAGGGTGAAATTGGCAGGGAAGAATTTAGGATGGAGAGGGGAGAAGTAAGG
GGATAAATTGTTGAAGGATATTTGAATATGGTTAATAGAAAACCTAATTGGTATTGAAAT
ATCCAAGCTTGGGAAGATACTGCCTTTTCAGATGCACCTAGGTGTGTCTTGGAAAGGTGT
ATTTTGGGTGTGCCTCTGACAGCCAAAGCCTCAATACAAGAGAATGCTAAGGGTTGGAAA
GTGCCTGCCCATTTTGAGGCAAGTTACTTGGGAGGGGTCTTGAGGTCTTTGCTGGGTGAC
TTGGGGCAAAGTCAGCTTGGATGGCATTGATATGCTCTTCTGTAAAGGTGAGAAGTTTCA
GCTCCCTACAGACTTGACCCGGGTCCTCGCACCACTACCTCCCCCTTGAGCTGACCTGCT
GCAGCCTGCCAAGGATGTAGTAAGGGGGATAGAGCCTGGTTTTGTAGCAATAAGACATTT
GAGCTTTCTCTTGGTGGGCATTCTCTTTGGACTCTGTCTCTATCTCTTGACTTAGAATAG
CATTGTGGAAGCAGAGTGGTAAGAAATAGCAGGACATAGATGAGGCAGGATTTGAAGAAA
GAGAGCAAAGGAGCCCTCCTGGGTTTCAGTGAGCTCAAGAGAAAGGTAGACTATGTAAAA
ATGGGCATAGACAAAGAGATTTCTGAGCATCTAGCAGTTTAATTGTACATTCAAGCTTGT
AAATAAATATATTGCATATAGTTAAGGAAATGAAGTTAGCTCACTAGGCTAGCATGTTTT
AACCAAGCCTTCTACCTCATTTGACATTATTGGGAATATATATTATAAAATGTAGGCAGG
GCGGGGCGGGAGGCTAGGTAGGGTGACAACAGGGGCGTCCGGTCTTCTCTGTCTCTAGAA
AGCAGGCAACCGGAGGGAAGATGGTTTACATCTTGAATGGTCAGGTGTTGGACAGCATTA
ATCAGTCCCTATGGAGAGTGTCTTTCCTAACAGACTTCTGGGGAATAGCAGAATTTGTCG
TTTTCTGTTTCAAAACTCTGCTTCGGCAAGATGTAAAGAAAAGAAGAGGCTACGGGAGCT
CCTCTGATTCCAGATACGATGATAGAAGAGGGCCACCAGGAAACCCTCCACGAAGAATGG
GTAGGATCAATCACCTTCGTGGACCCAGCCCTCCTCCAATGGCTGGTGGATGAGGAAGGT
AAATGTCTGCTCTGAGAAGCAGACAACTAGACATACACACGTGTAGAAGGAAGCCATCAA
GCAGTGAAGAGCGGCTCATGCAGGAGTAGATGGTGTATGTCCAAACAAGGATTGCTCTGT
GTCCTCACAGATGAATGAGGCCATGCTGGAAATTCCCTCTGCAGGATCTGGCCTGACTGA
TACACAGTTCTATAAATGTACATGTTTGTCTACTTATCTCTTTTTTGTATAGTTTACGAT
AGTATTAATATAGTTTTAAGAAGTAAATATTTCCAGGTTGCAAAACTTGATTGTTCATCT
TTATATGATCATACCCAAAATCTTTGATCTGGAAGAAATAAAGGCCATGTATTTAGTCCT
GGAAAAAAAAGTGTAAAAAGGTAAAGGTTACATGAAGTGGTGTATTATGATCTAATTTAA
ATGCATAAAAATTAACTTTACAAGAAAAAATATAATAAATACAGATATAGTTATGAGCAA
TTGATGTTATTCCAGGTAATACAGATTGCATTTCAAAAAACCTCATGGCTGTAATTCAAT
TGCTGTAACTGCAATCCAGAGGGGTATAATGCCCTCTTCCGACCACTGTAAGTAATGCAC
ACAGACATGTTCCAGCAATAGACTCACATAAGTAAAATAAAAATAATGTATAAAATATGG
AATCTTCTACAGAGATGTCACAGCCTTGAGACACACAGCATTCAGGATGCACTTCTTTCT
GGTCCTACAGAGATGCACCTGTGCCTTTCCTCTGAACCAAGTTGCTTAGTTAAAAAGCAG
CCTTATTCTGAGGTTAGACTAGATCAGCAAACCTGCTCAAGTAAGAATGGTAACCACAGT
GCTGTTAGGTGATGTTTCCTTGATATTTTCTGTTTGTATTCTCTGTCCATTGTATATGGA
GAGTTGTGGCATTGATACATCTTTTAAATGTACTTTTAGATCATACATTGTTGACTAGAA
GGTCGTTTTCCTCGGTAAATCTCCATCTGCCTCTGTGACTATTGTTCAAACTATAGCTGT
GGCCCAAACCTAAGAGAGACTTAGGTACAACAGCATATTGGGAACTAAAAATTCTGTTCT
AGGCTGGTTCTTCTTTGGGCATCAGTCAAAGATGAATGAGTGATCTTTTCCTACGAAAGG
ATGCTAATTCTACCTGTTATACCTTCAGCCTTTTAGACAATTATTTCTGAGACAAGGTTT
CCTATGGTGAGTCATGTAGCTCTCATTCCACTCTGTTATGTCTCAGGGCAGTAACATTGC
TATCCTATTGTTTAAACCAACTAAATTCTTTTTTTTTTTTTTTAAGATTTGTTTATCGAT
TATACACTGTAGTTGTCTTCAGACACACCAGAAGAGGGCATCAGATCTCATTAAGGATGG
TTGTGAGCCACCATGTGGTTGCTGGGATTTGAACTCAGGACCTTCGGAAAAACAGTCAGT
GCTCTTAACAGCTGAGCCATCTCACCAGCCCCCCACAACTAAATTCTTAAGTTAACATCT
GTACCACCACTGTGTTTTAAAATTATGCATTTGAGTCATGTAATCAACTGTTTACTGAGT
TCATAGGAAAAGCATTTGCATGAGGGGCATAGCTTCTGCATTCTGACCAGAATAGGAAGA
AGTTTATTGTGTGCACTAATGGGGGAATCAGGGTGGGTAATCAGCTACTGGAGTCGCCAT
AATGAAAAAGTGCCTGATGCTGGCATGGAGGTAATTTTACAATTTTGCAGCTTGTCTTAA
TTCATGTTGGGTAAATGAAAACAGACTAGATCGGTGGGTGTATGATTTGTGATGTCAGTT
AAGCCAGTGAATACTCAAATTGCAGTTAGGTTACTACTGTCCTATGAGATATGTGCAATA
CTCATTGACATAATTAAATCAGCTCAGAAATGTAAAACACAGGACTTCATTGGCTGTAGT
TGTGTTTGAAGTTACAGGTCTCAGCAGGCAACAATCCACATAGAGGCAAGGTCAAAAAAT
ATTTGAAAGATGCTATTCCTTCTACCAGGAAATGGACTATTCTTTTACAAAGTCAGAATG
GCTATGTGTTTTTTCAATAATATTTCTGTTTGTAAAAAGTCAATTATTGGGGCTGGTGAG
ATGGCTCAGTGGGTAAGAGCACCCGACTGCTCTTCCGAAGGTCAGGAGTTCAAATCCCAG
CAACCACATGGTGGCTCACAACCATCTGTAACAAGATCTGACGCCCTCTTCTGGAGTGTC
TGAGGACAGCTATAGTGTACTTTACATGTAATAAAGAAATAGATAAAATCTTTAAAAAAA
AAAAGTCAATTATTGGTTTGCTTTAAATGCAGCACTTATCTGATCTCTTACTTGTATTCA
TTCTGTGATGTTTCCCAGAAATAAGAATTTCTTACCATTTCTTTTACAAGTGCTGCTTAG
GACAAGGTCTCCTGAAGCCCAGGATGGGTCATGCCATGTAATTGATAATTGCCTTGAACA
TCTAATCCTGTCTCTAAAGCCACATGTTGGGAAGACAGTCCTGCATCTCTTCTAGGCTAG
GCTTTGAAGGTGAACATTTTCCTGGTATGGCTGTACTTGACATTAGCAATGAGTAGTGAG
GTCACCAATTTTCCATCTTGATAGTCACCTTGACTGGCCATTACTCTGGTCTGCAGACCC
GGCAATTAATAATCTGGATAAAGGGGCTAAGGAGAAGGCTCAGTGGGTAAGAACACTGAC
AGCTCTTCCCAAGGTCCTGAGTTCAAATCCCAACAACCACATGGTGGCTCACAAATATCC
ATAATGAGATCTGGAGTGTCTGAAGTCAGCTACAGTGTAATTATGTATAATAATAATAAA
TAAATCTTTGGGCCAGAGCAAGCAGGGACTGAGTGGGGTTGACCAGAGTGAAGTAGAGGT
CTGAAAAATTTAATTCTCCACAGCCACATGAAGGCTCACAACCATCTTTACAGCTACATT
GTACTCATATGCATAAAACAATAAATATATAAATCTAAAAAGAAAGACTCTGGATAAAAA
CTGAACTTCTTGTCAACTGTTGTTGCCACCAATGCAATTATTTCAAATGACTATAGTTAC
AGGAGTTCAGTTACCTAAAACCAAACAGATGGGCACTCTGAGGGGTTTTTATTATTTTCA
CCATTTAACATGGGAAAACCCTTCTTTACTCTGGAGGTTTCGGTTAAGTAGAAAAAAAAT
TAATCCAGGCCAGAACTTCTGCTTTGAGCCCACATATATAAAGGATATTGAAGATGGTAG
TTCTTTCTCTTTCTCTTCTTCCCACATAGTGGCTTGCAGGGTCTTTTTATTTTTCTGACA
TTAAGGCTCCATCTTTGGAATTCTGTTACGTGCTGAACACCAGCTGAGACATACAGGAAC
TACTGTTTTCTTCAACTCTTCATTGGTACAGTCATTGATTTACTAGTGGGGCCACATTCT
GTGAGCCATTCTTATCTATCCAATTTCTGCATACTTAGAGAGATCCATGCTCTGAGTTTT
GTTCATCTGGAAAACCTTTACTAATACAGATATGTTTTTTCACCTGCCCCCGTAGGAAGA
TGTGCTGGCTAACAACAGTGCTCCATAGTGATTGGCATCCATCCCCTGCTTTTCCCCCAG
GGTTGTCTGGAGTCTCATATGTAGCAATTGCATATTAGCTGTGGTTTTCCTGATGTCAGT
GTAAAATGAGAGGAGCAAACATCATATTTTATGTCCTAAAAATCTCTCTTTAATTGTAAT
TATCCTTGGAACCTATGGTTCACTCTGCTCCAAGTTGAATAATGTACTATGCAAGGTGTG
ACTCTTGATTCCTTGGTGGAGGAGGGGGCGGAGCGAGGAGAAGGTGAACAGGCGGCGGCC
TTGGAGGAGCAGGAAGAAGAAATTCCTGCTGAGTTCTGGATGACAGAAAGATAGACTATT
GGAGGAGAGGACTGAAAGAAAGTCTTGCAGATCTGAAAAGGGTCAGCTCCTGGATAAGAA
ACCCGAACTGGGAAGCCATATGCTGTGTGCCTTCAGCGCACTCTAACCCTAAGGGAGGTG
CTCATGTCAATCAAGTCTCACTAACCAATCAGGGCCTCCGGATAGGCCCGCCAACAGGAG
GAGAGGCGTGTTCTTCCGTGTGCCTTGTTCCCCTGCTCTCTGTTCCTCTCTGTTGCGAGC
AAGCTGAAAGATTGGTCTGATTTGTTTTGATCTCTGCTGCCAGGGGCCTTAGGGCAATGT
CAGCGATCTACAACGTGGCGACATGGTGAGCGTGTGACCACTGCCCTTAAACGGAAGGAG
CAGGGGGCTAAGCAGCTGGAGTCGGGGTGATGGGATGCAGGGGACCGGCCCTGGCCATTC
TTGGTTCCTCTTCAGGCAGCGGAGGGGGAAGAGTGTCTGAGGTGACAGAACTTGGTCTTT
AGGGATGTTTAGGGTTGCTGTTTAGTATTAAGACGTTTGCCTATCTTAAGTCTCAGTCGC
GTTGCAGCCGAAGCTGACCTGCCGGAGTTCCTCTGAGGCAAGGCTGGACACTGCAATCAG
GTATTTAGAGCCTCCTCTTAAAAGACAGGGGATTAAGTGAGTAGCTTTTGTTCTATCTCC
ACTGAAATTGAGATACTCTTAACTTCCAGCTGCTAGTTGAAGTCACAGGAAGAAAAGTTG
GACACTTTTAAACATCTCTTTAATCTTTTTTTCCAAGTTCTTCTAAAAAGTTTCCTATGA
AAGTTCTCTATGGAAAGGGAGTGGGTGATTAAGTAAAGGAGTCATTGCTAGAGCCTTTCC
CTCTTGTCCAGATGCCTCTTGCTTGCTAAGCCTGGGAGAAGTTTGGAACAATAAACTTCT
CTTAAACCAGGAGAAGACAACCACCCTCACAGGAGGAAAGGCTTTTTACACAAGCAAATA
AGAATAAATTTACATAAATTCATATACGAATTCATACACTTTTGAGAGGTTAGTTTGGTC
CAATGTATGTTGAATTTCCAACTAGAGGGGACTCCTTTGCAGATATGTCCAATCCACTTG
CACAGTTACTTCAGCTCAG
Chart Advanced