SelenoDB
Release 2.0
Chart Advanced
Sequence Report for SEQ00001380_2.0
Identity
SequenceSelenoprotein R (MSRB)
SpeciesMicrocebus murinus (Mouse Lemur)
DescriptionGenome -assembly-
Sequence IDSEQ00001380
Sequence release2.0
External IDNone
Gene SPG00001381_2.0
Annotation
Prediction method(s) None
OrientationReverse
Toolbox Forward Reverse  
Sequence
>SEQ00001380_2.0 # Sequence # Selenoprotein R  (MSRB) # Mouse Lemur 
GAATCCCAGAGCACCCAGAGTTGCTGCGCAGGAAGGGGCACTTGGTTAGCAAGCAGGTGC
CCTGGGGGCTGCTCCAGCCAAGGAAGGGGGCACCGCAGGGAGAGAGGGGCTGCACTCTAG
AGTCTTGTTTCTCAATGGGGAACCGGGGTGGCAGGCCAGAGGCTGTGGCAACCCAGCAAG
GGGGGGGGTGATCTGTGATTGAGACACTCCAGAGCTGGAGATACCATCCCCCTCTCCTTC
CATCCCCTGGAGGATGGACCCTGCCCACAGCCACCCATCTCTGGGCTCCCCATGTGAGGA
GCCTCGGGGTCCTGGGGCCCACCCCAATCTCCCCACCTCCCTAAGAACTCTGCCTCCCAG
CCTCCACTGGACCCCAGCCCAATCGCCCCCTAAACAGGGACGTGCAAATGAGTGTGGGGC
ACCTGGGGTGCAACCACCCCCCAGTCTCAGCAGCCCCGGCACTGGCCCAGATCATTCCCC
TGGGCACCAGTGGGTTCTTCAGCCCACTCAGCTATAGGCCTGAGCCCGCGGAGACGGTCC
CAGTGGCACGGCACAGCCCTGGTCATGCTGGCCCAGTCTGCAGGCGAAGCCAGTCTGTTC
CTTGGCCCAAGTCCACTTTCAGGGACACACTGGACCAGGACGCAGAGCAGGGAGTGCCGG
GACAATGAGCAAAGCCCCAGTCTGTGACCACGAAGCCTGTGACCACCCAGCCGGCTCCCT
CCCCACCCCCAGCAGCTGCTGCCCTCGAAGGTGGCCAAGGCCTGCCCAGAGCCACTATTT
CTCATTTAGGGTGAGGGTGAGAGAAAGGGACAGGTCTGGGCAGAGAGGACCTGAACTGGC
TGCCTGGAAGAACATGTGGACCCCATGCAGCCCCTGCTGGGCCTGCCTTCACCAACTGAC
CTGCCTGGGACTGGCCCGGAGCAGAGACTGCAGGCCCCACATGAAGCGGAGGACATAGGG
CTCTTTCCGGCTGTGTGGCCTCAGACACATCACTCCCCCTCTCTGTGCCTCCCTTTGCTC
CCCCAAGAACGAGACTGAGGAGAGCAGCTGGGGCTCTAGGGTACTGCGAAGGCTAAGTGC
AGGCAGCTGGGCGCCCCTACTGAATGGGGCCCCTTTGTCAATGCTGACTCCTCCCCTCCC
ACACACCTCCCTCGGCTAGGTGTCTGGGTGCTAACGCACAGAGCCACACACACAGAAGCC
ACGTCTGCATCATCCCTGCCCTCTCCACGTGGCTCTCCTATGACCTCACCCGACAAGGAG
ACCAGGTTGAATGTCCCACTCAAGGTCACGCAGTGAGTAGGAGGCCCGCCAAGGCCCAGC
GGGGCAGCCGGCAGCCCCTGTACTGACTGCTGGCTCCGGTCAGAACAGAGGCCCCCAGCC
TGGGGTGCGGAGGGAGCCTCGCTGTCAGAGTCCCGTCACTGAGGGGTGAGCGGGCTGACC
GGGCTGGCAGCACGGCTGGCCTCTCCTGCCCCCACCTGCCCTGCACCTGCAGGCTCCGCC
CTCCCATGCAGGAACGCGCCCTCTGCTGAGCTCGTCTGTTCCAGTCATACCTTCCAGAAC
CAGGGAAAACCACGGATGGGCCCACCGGGATCAGACCTGAGCTAAGGCTCCATGGGTCAC
CTGGCCTCCACTGGCCCCTCCTCCGACACAGTGAGGTCTGTCTCCTGGAATTCACATCAG
TTCAGAGCCAGCACCCAGCAGTCCCTGAAAGGTCTGGTGATTTCCTTTTCTCCAATGCAT
AGTCACCCTGGTGAAAGGCCATATAGGCCCCTTTGGAGAAGACTGGGAAAAGACTAACAG
GATAAATTTCAGGGCCTTTCCTCAAGGGGACTTGGCCCCCCTTCATTCAGGGGCTTTTGG
GTCTATAACCTGGCCCCAGTCTGGGAGTTGATTGCGGGCCGCGACTCTGGGTTTTTATGT
CAGACTATTGTGCATGTGACCTAGAACTCATCAACTCTTACACATCAAGTAAGAATTCAA
TAGACTCGTCTATTTCACTTCCAGGAACACCGTGACTGTTCAGATGGCAGTTGCTGCTTT
GACCTTGCTGTCCAACACAGCGGCCATGCCCACCTTGTTTTGTAGGGTTGACACCTGTAG
CCCGTGCCACCCCAGGATCTGACTGCTCTGCTGCACTTCGGTTTCCTAACTCAGTAGCTG
CAGCTGCCGCTGTGATGTCTGACCTGCAAGAGAGAACCAGGCACAGAGCGCTTGGAGGAG
GCTGGGGCTCCCCCACCCAGATTCATTTCTCACGGGCATGGCAGAAGGAGTGTCCCCTGG
ACCCTCCCAGGCAGGGGAACTCACCCCAATCTCCCTAAGCCTTTGAATCCTGTCCACTAC
AGGTGTGTCTGGCATTTCACCATTTTGCGTAGATCACTTTTGGCCCACGCTTCGGACCCC
AACCACCAACCAGTCAAGGCCCTTTGTAACCCCAAGAACAGCAACATTCAGCACAGAATC
TCTGCTTGGTGGGCCCCCATCCGTAAATGCAGCTGATCCGCTTTATGTTCCTTCCCCGTT
ATCCCTGCAGCAGGGTGTCGGTTCTTCCCTGCTTTCCTTCTAGATCCCGACCCAAAATTA
GAGTGCCTCGACATTTTGTGACCCAGCTGCAGTTTTGGGGGCCTTGAACATTCCCAGGCA
CTGATAAAGGTATGAAGGTTGTTGCCCAAAGCACTGAAAGAAACTCTACCTGGCCCTGAG
CCAGATTCCTTAAACCTTCATATACCCCCATGCCCTGCCCCTGGCTGTGGACTCACCTAG
GCAGGACTGCCCTTTCCTCTCACTGTTGAGAGGCTGGCTGCCACCCTCTGTGAGCAAGTT
CCCCTAATGTATGCTTCGGACTGGGCACCCAGCGTTCAGCGCTGCTTTCTTTGGGTCCCA
GCTAGCCCCATTCCAGGGTGGTTTGGGGCACTCCTTTGTGGGGACTCCCCTGGTACCACT
TTGGGGGCGATTCCAGCCATGGGCTCAGAAGGACGAAACACCCACCCTTAATATCCATTC
CCACACTCTTCCCCAGATGTCTGTCAATATAAATTGGGGAGCCAGGCGCGGTGGCTCACA
CCTGTAATCCTAGCACTCTGGGAAGCCAAGGCGGGGCGGATTGCTCGAGGGTCAGGAGTT
CAACCAGCCTGAGCAAGAGCGAGACCCCCGTCTCTACTATAAAGAAATTAATTGGCCAAC
TAATATATATATAAAAATTTATCCGGGCATGGTGGCGCATGCCTGTAGTCCCAGCTACTC
GGGAGGCTGAGGCAGCAGGATTGCTTGAGCCCAGGAGGTTGAGGTTGCTGTGAGCAAGGC
TGACACCACGGCACTCACTGTAGCCTGGGCAACAAAGCAAGACTCTGTCTCAAAAAAGAA
AAGAAAAGAAAAAAAAAATATATATATATATATAAATTGGGGAAACCGAATAGTTCTCTT
GGAGCGTAGAGCATCTCCTCATGGGTCACACCTTATATATCCCGCTTCAGGGCCCAGCCA
GGCCAGCTTTGCTAGGGGCTCAGGGCTTTTGCACATGCTGTGTCCGCTGCCTGGGAGCTG
CTGTCCTCAGTCTCACCTGTCACTGCTGAGCTGAGACAACCCCTCCTGGGAGTCCTCCTC
CCTGTCTCATGGAGCCCCCTCAATCACCCCCCCCCCACATTCTGGCATTGTTACTCTTCA
GTTGCTCCCGGCCCTATGAGGACATGACATTAATGGACTGCCACGCACCTCCCCAGCTAG
GCCGCGTGTCCTGGCGGCCACAACCCCATCTTGCTCATAGCCGCATCCCCAGCACCGAGC
CCAGAACCGGGCACACAGAAGATGCTCAACAAATACTTTTAAACAGTGCAAAGGTCCGAC
ATTCACATCCTGGCATAAAGACAGCAGGCCTGGCTGAGCGCAGCAGTGAGCACCTGTAAT
CTCAGCACTTTGAGAAGCTGAGGTGGGTACATGAGGCCAGCCTGAGCAACATAGTGAGAC
TCCCATCTCTACAAAACATTTTTTTAAAATTCGCCGGGTGTGGTGGCATGCGCCTATAGT
CCCAGCTACTCGGGAGGCTGTGGCAGGATGGTCACTTGAGCCCAGGAGTTGGAGGCCACA
GTGAGCTAAGATGAGGACACTGCACTCCAGCCTGGGAGACAGAGCAAGACCTTATCTCAA
AAAAAAACAAAAAAAAAAAACAGTAGGCTTGCATTGCATTTGTTTATTGACTTCCACTGG
ATTACTCCAGAAAATATTCAAAGATGGGTGGGGGGATGTCAGCATCGCCCACCTCCCACA
TGGCAAGAGCTCTGAGCACGTACAGTAAGGCACAGTCCCCAAGTCTTGGGAAGGGACGTC
TCTGCAGGGTGTCAACTCCAGGCCCCCAGCGCTGTGCTGGTTAGGGTGATGGAGCAACAG
CCATTGTCCTAAGCCAGAGTGAGGCAACTACATCCGCACAGATGGTGAAATGGCGTTTAG
GCTTCTCCCTTCATGGACAAGAGACCAAGGGTGTGTCCCGCCGGCCTGCTCCCCCAGCGG
GTCACGGACATCACCACTCTGGCTGGCCTGGACGGGTTTAGCCAGAGGGGATCATGAAGT
GACCAGGGCCGGAGCAGCTGGCCAGGGCAGCTTCTGTTGCATTCTGTCACTTAGCCCAGC
GGGGGAATGTGGGTATAAGCTTTGGTGAGAACCAGAGCTTTGGAATTAGACCCCGAGAGG
TGAGTCTAGACAGACAGGGAGCGGGCAGTGGGCCGGGTAGAGAGGGCGAGGGTGTGACGT
CATTCAAAGATGAGCTGCACCAAGCCCACCTCCTTGGAGACTCCTTGATTGAGCGGGAGG
CCAAGACAGCTGGCTGGTCCTGGCAGGGGGTATGAACTACCAGCAAAGGAGACCCTGTTC
AGAACCAAGGCATGGGAGCCTTCCTGACGTTTCGGCCACCCCTGCCGGCTTCCCTGTCTG
AATGTCTGGGGGTCCAGTTCCAAGGCAGGATGGCCAGAATGTGGCATGGCATCGGGTCCA
TCTGGAGTGTGGGCTGCCGCCTAGTGTCCCTGGGAGGCAGAAGTTTCTTTGCCTGGAAGA
AAGGAGGGAGGGGTAAGAAGAGCAAGTCACCATGAAGTCATGCTTCAGACATGTGCATGG
GAGAGGGAGGGACAAGATGCCCCATTTTGTTCCCTGAGATCTATAGGAGAACCCAGAATC
TCTTCTTTCTCCACACAGATGATGGGCAAATAACAAAAGGACAAAAAGTCACTGCATGCT
TGCCATGCGCCAGGCCCTACAGCCGGCTCACAGACCCACAGCACAGCGGTGGCAGTGAAC
ATGTGCTGCTCACAGCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNAAAAAAAAGGATTTGCTCGAAGGGTGAGGACAGGGGGC
CAGAGAGGGGGCTGCTCTCTCGATGAAATGCACCCCAGGTGACAACTCCCCCGGACACAA
ACTACAAACAGTAAGAATACTGGCAACAGCAGTGCAGACTCACTGAGCTACTACTATGTG
CCGGGCCCTGGGCGCACACTAAGTGCAGGTGTCCTCGGCGCCTGTGAAGGAGGCTCTGCC
ATGCGCCACTCAGCAGAGGAGGAGCTGGGCTCAGCCAGGCTGACGGGCAAGCCCACAGCC
ACAGCCGGGAGGAGATGCATGGCCCAGGTCCCCAGCCTCCGCCCACCCGCCTCTGATGCT
AGCCCCGGGGAAAGGTCGGACCTCTGGAGCAAACCCTCTGCCACGTATTCCCTAGGACAA
CTCTTTCAGGGCACCCACGATCAACAAGGCAGAGGGAGCAGAGTGTCTGCCCTCTCGTCC
CTGCCCTACAGCCATCTTTGGGGATGGGGCTGGGCAGTGTGATCTGGTGCCCCCTGTACT
TTGTCACAAGTGGACGAACAGTGTGCTCCCCCACCCAGACCCTGGGACCTACGACAGGCC
CGTCCCGGCTGTGCCAGTTGCGCTCACCTTTAGGGATGAACTTCAGCGAGCTGCTAAATA
TTCAGAAGCGGGACTGCCCCCGCTTGGGGCCGTCATTCAGGAACTCGTGGCCCAAGCCAT
TGCCACACCTGCCACAGGACACCTGGGAAGACCACAAAGCAGCCACTTGAGCTCTGGCCG
TGAAACAGCCATATCGGTGCTACCAGCAGATGGTGTCTCTCTCTGCAAGCCCATCCCCCA
AGCTAGCTGCCCACGTGAGATCGACCTTCATCCTGGGGCCGACCCAGGAAGGCTGTTCTG
TTTCCCATGTTCCCCCCGGGGCACCAGGCTTTCCGGATAGTCTGGGCTGGCAGCTCCCGG
CTGAGGCCAGAGGCCTGGAAGAGACAGACTCAGCCCCCCGAGCTGTGGGGCAAGCAGAGC
GGGGAAGGTGGGACTGGCTCTCTGGCCCTCCCTGCCCCTGCCCCCTACCTTTAGGGCCTC
AGGCCGGTTGAACTCTGGACGCTTGGCCACACTATCAGCGTGGATGGTCTCGGTGAATGC
CGGCCATGGGGACGAGTGTGCATACTTCGAGCGGCTGGAGAACAGCTCGTAGCCACACTT
GGCACACACATAGATACCTGGCGCAGAGGAAAGGCAAAGGCAGACACATTGGCTCCAGCC
TCTTGGGGGCAAGCTCCCAAATCCTTGGACCCGGGCAAAGGCAGCCCTGCCCCATTCTGG
GGTGGGCTGCACTCCCTCCCCATGTACCCGCCACCCACAGGCCTCAGGCTGGCTCTGTGG
GGAGACACAGCACTGAGCTCGCACTTAGCGGCTATGCCAGAGACCAGGAAGGTCGCTTCT
CACACTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAAAAAATTAG
GGAACTTCAATGGGTACACCGATGCGCCTGGTAAAACCAGCCCAGTCACAGTACGTCCCT
GTGACTTCCATCGCGACCCTGGGAAGTCTTCTTACCCTGATGTTTCACCAGCGACACCAC
GTCCACGTACAGGGTCGCCCCAGAAACGGCCTCTTTGACCCCTCCCTCTCCTTGGGTACC
CCTACTTTCCCCGCCTCGCAGACTCCGCCCTCCTCCGTCATGCGCTTGACCCGCGGCCGC
TGCTCTCTGGCGGCCACGCGCCCCATTCCCGGTCTCGGGGCCCCATCTCCGCCGAGGGCA
AGGACGCCCGCCACCGCGCCCCCGCCGGCCGCGGCACGAACCCGGCTCAAAGTGGTTCTG
GAAGACCTCGCCCCCGAAGAAGCTGCAGAACGACATGGCGCCTCTGGGACCGCTGCGCGC
TCGCCGCCTCCGACAGACAGGCCGCCGGCCGTTCGACCGCCGCTCCGCAGGACCGGTCCC
CCACCCCGGCGCGGGCTCCGCTTTTCCGCTCCGGGAGGCCCCGCCCTCCCAGAAGGGCCA
CTCCCGGGCCGCCTCCCCGGAGGCCCGCCCCTCCGGGCCGGGCCCTAGCGCGTCGTCCCT
GCAAGCTCCGCCCATCGGCGGTCACGCCCTTCCAGGGACCACTCCCGGGCCGGCCTCCCC
GAGGCCCCGCCCCTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Chart Advanced