SelenoDB
Release 2.0
Chart Advanced
Sequence Report for SEQ00000973_2.0
Identity
SequenceGlutathione peroxidase 8 (GPx8)
SpeciesGasterosteus aculeatus (Stickleback)
DescriptionGenome -assembly-
Sequence IDSEQ00000973
Sequence release2.0
External IDNone
Gene SPG00000974_2.0
Annotation
Prediction method(s) None
OrientationForward
Toolbox
Sequence
>SEQ00000973_2.0 # Sequence # Glutathione peroxidase 8 (GPx8) # Stickleback 
AGGAAGGCCGTGACCTGTGACCAGGCACTTCTTCTTCTGGGCCCAGCGCAGAGAACAGAT
CTGCAATCCGAGTCATAAAGAACAGTCAGTCTCATATGTGAACGCACAGGAATCCGGAGG
TCTTGTTGGTAGCGAGGGGTTGTTGAACTGTCCCCTTAATCACCTGAGAATTTGTGTTTG
CAGAAGTCACGCAAGTCCCCGAATCGGTGTCCCAGACTCTCAGGTCCCCATCGTTCCATC
CGCCTCCTGTGGCGATCATTCCTCTTTGCCACGGACACCAACCCATTGCCTGAGCACAAA
AAAGACAAGTAAAACAATATAACAGCTTTGTTTTCATTTCAGAGCCCCCCCTCCATCACT
GACCTTAACAGCGCTAGGCTGTCTCATCGTGGAGATTGGCTGACGTGACCATGTGATCCC
CGCCATGTCCCCCCCCCAAATGCAGAGAAGGCCCCCTGTGGAGCCACTGGCCAGCCGGTC
GCCTCCCGGGGACCACTGGAGGCCGCAGACCTCCTCCGCCTGGACCACGGCGCCCACCAA
AGGCTCAGGAGCCCGGGGATCCAGGTGATGGATGCCTCCGAGAGCAGAGCCGCTGTGGTC
AAGCGGGTCAACAGTCATTCCTGCATGAGGACTTTTACGCTTCATATTTGTTGGAAAATG
TCATGTCAAGAAGGGGGTTTTAGACGAAACAAGACTGTGTCTGTATGGTTTGTACAATAA
GTTTGGTATTGATACCGGTTGTGATGCCCTTTATTTTATATATAAACAGAAGCTATGTTT
CCATTTGAATGTGGAGATCATTCCTGCTCTGATGGCGTTTGTAGAGTTCAGAATGATGCT
GAATTTCTGTGCAACTTTCGTTTTGCGTTCGGACAACACGAACCTGCTGAGTAAGTGCTG
GTTCCAGGAAAGCCCTCTAACCACGGAAAGATGTGACGGCAGACACCTCATGTTTCGCTT
GTGTTCGACATCCCACAGCTACCAAAGTCAGAGAGAGAGAGAGAGAGAGAGACCAGTAAC
CAGTCATTCTGCTGACATTACCCCCCTCCAGCCCCATACCGCACGTTTACATGAATCAGT
CCCACCCTCCCCGCTCTTTTCACGCCACCTGTATCTCTCCTTGCCGGGTCCCGATGCAGA
GGACGCCGCCGTCCCTGCTCCAGCTCAGGCAGGAGATGGACGGCGCCCGATGGCGCGCCA
GTCCCGGTTGTGGACTCGGGTCCAAAGATCCCGCCAGAGCCCCAGTTTGTGAATTCCACA
GGTAGACCGAAGAGCCCAGCGCTAACGCGAGCACACCTTCACAACTGCAGTCGAGAAGGT
GAGTATCTGGAAAGGAGAGCAATGGAAACGACAGAGAGCGTCCTGAGTCAAGTCTGGACA
AACTGTGCCGTCATGTTTGTCCCAATCCGACAGCAAGATCTAGAGGCAAGAGCAGGGGTC
ATGTGACTACAACGATAACAGTCCCTAACACACACCCCACAACCAGCAGACAAATTTGAC
CAGAAGCTAAAAGTTTTTTTTTTTTAAATGTTTCATATTTTTTGTTTATTGTTAAAGCTG
GAAGCTCTAAATCCTGTTTTCCGTCTCCACTATAGTACCCATAGACTTGCATACTGCATA
TTATAATTAGGGCTGTCAACAATAACGCGTTAATCTATGCGATTAATGTGGCCGGGACTA
AAAGATTTTAACGCAGTTAACGCAACTTTGTTTACTTCCGGTGTGCCGGATGTAAACGAA
ACCGCCGCTAGCTACAGTGAGTTAGATGGGAGAGAGCAGGTCGGTAGCTGAAGAGGAAGA
GAGTGCTTTGCATTGCAAGGAAAACAAACGCAGAGGAATTCCATCACGTGTCAAACAGAA
GAGGAGTGAGTGGCAAACGGAGCACTTTAGGCACCGCTAGGCTAAGCTAGCAGAGGACCA
CTACTGTGTCAAAAACAACCAAACCAATCGCAATTAATGTATTTCAAAATGTGCGATTAA
TTCGTTTTTTTTTAATCTATTGACAGCCCGAATCACAATATATATTGTTTATTGTCTCGT
TGACCTATGAGAAATGACTTGATTTAAAAAAGCCCAAAGCAAACACAATCTATAGGCCAA
GGTAGTGCCCCAACAAATCTACCATTACCTGCAATTTATATTACATTGGCTAAAAACTAT
ACGTTGTCCAGCTGTTTTGGGAAAAGATGCAGTCTTATATAAAAGTTAAACTGTATATTT
GTGACACAGACGGGTTAGGCGGACTAACAGCTGTTGGTTTGGTCTCTTTTCATATAGAGA
TACAGAGATTTGCTTCTTCCTCTCTTACAGTAGTCATTCAGCAGCGACGGTGCCGCCAGC
TTCATCACTGACTTTCCCTGCTGCCTTGTTTTTGTTTCGTCCAAGAGAGCAAAGGGCTGC
AGAGCACGTCTTCTCTCATCAGTCCCTGTAATGCGAAACACATATTAAACAAAACCCAGT
TACGACACATAGAGATGCGACAACTGAAACTCACTGAAACTAAAATGAAATCCTATACTT
TGATGGTGTCTTATGAACCGGATCTAATGTGATGATACATAAACAAAACCGCCCCCGGGC
CTCGTGCACTCTCTGTTGCTTGGAACCCTTTCTGCAGATGGTTTGGCCCAGGCGTTCTCC
TGGTGTGACAAAGTGCAGTACGCTCTACGGCAGGGGTCTTCAACGTTTTTCAGGCCAAGG
TCCCCCAAACCGATGGCGAGACGGAGCAGGGACCCCCTATTCTACGGAGTTTGGTCTGCC
ATCTTTTATTTGTGAGAAAAAAATTGGTTGAAAAAAATAAAGTAAAAAACAATTAAAGAA
ATATAAAAAAATTGTCTTATCAACCAAAAAGTTCACGAACCCCCTGCAGTACCTCCGCAG
ACCCCCTGTTGACCTCTGCTCTACGGCTCAATTACACGTTATTTTCGGGGGGGTTACCGT
AATAAAAATCATCAAGAATGTGATAAAAAAAAGGAATATGCTGTACCGGCCTGATATGCA
CCTTCATGTTCTGGAAACGCAGCTTTCCACACCCATCCCTGCAAAAAGAGAAGAAGATTT
CCTCTTATAAATCTTAGCATTGCTTTTTCTAGTTTGTTTTGGTCTCAAAAGGTGCAGTTC
CTTGAAACAGAATGAGCAAAAAAAACAGATCTGTTGTTTTTGCATCTGTCTGATCGCTGC
TTTTCAACTTTGTTATTACTCGGATCATGTGATAAATAAGAGGTACCTGTTGTGGGGTAT
TTTCTGGTGCGGGCCGTCCCCCGGCAGGAAAGGAGCGTGGTGTGTTTGCTGTCTCTGATT
AGGAGAGATGATCACAGAAAACACTTCATCACAAAGTGACAAGGAATGGACACCTGGGTG
TTGACATTACGTTTGTTTGGGATGTTTTACGTGCAATGCATTTGGACGCATGTTGTTTTC
AGACTTTTTCACATGTTTCTCTTTGCACAACAAAAACTGAAATCATTTTGGATTCATGGG
GTGATTTATTCCCCCCCAAAAATGATATATTTCTACTTCAGCGTAACACAATGTACTAAC
ACGTCCATAACACAAGCATTCCTATACCAGTTTTGCCCTCTGATTTTTATATTTTCCGAT
ATTATGCAGTAAAAATACCTAACGTTTTAGATGCCATTTCCAAAAGCCGAATTTTAAAAC
CCCACCAATAGTTTTGAGTTCTAGATGCCCAAATTCTTCTGGGGAAAGTAAAAATATCAT
GTTCGAAAACAATGAGCAGATCAATCTGTGTCTTTGTACATTCAATTGTGGGGAAGAACA
CAAAAATAAAGTTTTTTCTTCCATTTTTAGCTATTATTTATTGATATAGTGTAGCGATAC
TATATAAAATAGCAACTCGCCATATATGTTGATGTGATTGTGTACTTTGTAACCTGTTAA
AACTTAAAATAAAATAAAAAATAGCAACTCATTTGGTGATCTGTGAGATCGCTTTTTGTT
TGATGACGTCACACAGGGGTCCGAACAGTACCTCGGTGCCGGCCGTCCCGGGCCGGTTCG
CGGATTCTCGGCGGAGAATCCAGCTGCAGCCTCTGGCGGACCGTGTGGAGCTGAAAGCTG
GACTCACGCTGCCGCCAAGTGGCCGGCGGGGGTCCCGCTGCCAGCGGGGTGCTGGCGGCG
GGACCCCCGCTGGCGCTCCGCCGGATGATCCGCCTCCTGAACCGCTTGTACGAGACGCGA
TGGGCCTCGATTGGTCCCTGAGGAGAAAAGGGAACGCAAGAAACACACAAAAAGGCTCAA
TAACCTCAGAAAACAACTGACACAAACTTTACAACTCTACACATTTTAAAAAGCACAACT
AGTTATCGAGGTAAATAGCAACACGTCCGGTTAAGACTTTCAAAGCAAAAGCATTGTAAT
TATTAGTCCAAAGGTCCTGATCTTAAAGGTGCAGTATTTGACCATTTCAATTCATCCTGC
ATTAAGCCTATTGGTTTGTAGCTACAGCAACACTGTGTGTTAAAGCAGGTTACATACATT
CTGCTTTCATATCACAGCTAATTGCATGAGTTGAAGAGTTGAAACTAGATTGAGACAATA
AACTCGTGTTTACATTATTTAAAGAGGGAATTCATCAAGAGGAAGAACAATCATTATCTC
TTAGACTTTGATGTAAACTGACTAAATCTTCGCAACTGGAGGAGTCGCCTTTACTGTGTA
CCTGTTACATGCCTCCGACACACGACGTCCCGACATTCATTTGAACTCTACTCTTATTTT
GGAGAAGCTCTTGCGCTCAGCTTCCGGGTGTCGCCGACGCGTCCTCGCTAACTTCAGCCA
GTCTCTCCCCGGGACTTTCTGCAGGAGGCTCCCGTCTGCCCCCACGGTTCACTCCCCTCG
CCTCCGACATGGAGGCCTTAGGGGGCTACCCCGCTAAGTCCAGCAGCCCCAAAGCGCGGA
CTCTGCGGGTCGTGGTGAGCATGACGGTCGGCGTGGGCTGTTTGCTCCTCCTGCAGACGC
AGCTGAATCCGAGGAAACCCGCGGACTTCTACGCGTTCGCGGTGAGGGACGCGAAGGGGA
GGCCGGTGTCCCTGGAGAAGTACCGAGGAAAAGTGAGTCCACGTCCCCCGGTTTGCGGAG
AAAATGGGTGCAAACTGTTTGTTTTCGGGTTTTTTTTTTTTAGGACGCGCGAGGTGCGCT
TCGTTTGGCGGTGGACGCGCACTGACTCCCCCCCCTCCTCGCGTCTCCCCCCTTTCTTTT
GACAGGCGTCTTTGGTTGTAAACGTGGCGAGCCGCAGCGAGCAGACGGAGGCGAACTACG
TGTCGCTGCAGGAGCTGCACCGGCAGCTGGGCCCCTCTCATTTCAACGTGCTGGCCTTCC
CGTGCGGACAGTTCGGGGACACGGAGACCGGCACGAGCCGGGACATCGAGGCCTTCGCCA
GGTCCACCTACGGCGTCACCTTTCCGTTCTTCAGCAGGATCAAAATAATGGGCTCGGAGG
CTGACCCGGCCTTCAAGTTCCTCACAGGTCGGTATCGAACCCCGAACAGAGAGGGGCAGT
GCGCCGTCACGGGGATGAAGGCCCCCAAAATTTAACCCAAAGACATCAGGGATTCTTTGA
GGAGGGAACTTGAGCATCTGTCTGGACCGAACTTCTGCCGTCAACAACAAATGTTAGTCT
CTCTGAGTCTCCGTAGTACATTTGCGATATTCTATATCATAAAACAGTATTTCACTAACT
CCTGTTTTCCCCAAACAAGTCGGACTATGTTTAAAAAATGTAGGTGTAGGTTTTTAACCG
TAAACCTACTTGAATATATAAACGCCTCAATTAATCAACCTTCTCTCTTTGTTAAATCAG
CATCATTTTCATCTCAGTGGCGTAGCTGCTCCTTGTACCGAACCCTTTTTTTTAAGTTTT
AAATTTGCGATCATCTGCTGTAAACCATGGCGCTATCAGGGTGGGAAAGTGATCCGTTAT
ATTGCCGTGATGACAAGACCCTTTTTTGATTTCATCCCATAGTTACCGTATCATCGCTCA
TCGTATATGGATATAAATTTGATCTATTTCACACTATTATTGATAAAAATGAGTTCAAAT
GCAACTCAGTCAGTCATGCAATAACCCATCAGAAATAACTTGAGGTTGTTAAATGCTCTG
TTAATGAGTTCTCGATGTGTTATGTCCCCAGATTCGGTGCAGAAAACCCCCAAGTGGAAC
TTCTGGAAGTTCCTGGTGAACCCAGAGGGGAGAGTGGTCCGCTTCTGGCGAACAGACGAG
CCCGTGGACAGCGTTCGCCAAGAGGTCACGGCCTTGGTGCGAGAAATCATCCTGAAGAAA
CGGGTGGAGCTATGATGGTCCGACGAGACAGCGGACGTGCGCCTGTTCGAGTGTGTCCTT
TCCTTCTAAAGGAAACCACTGAACTCTGAAGTGTTACAGCCGGCCCGGTGGGTTGGAACA
CGCTGGAGGAAAAGATTCCACTTCAAGCCCTTGAAGTGCGTGGTAGTGTGTGCGTGTGTG
TGTGTGTGTGAGATAGGTAGTGTGTGTGGAGGGGGGTTGTGAGACCTTCCTGCGGTTAAT
AATGACAATCACAAAGGACGTTCCTCATCATGACCACTGCTGAAGGGTTGTTTAGCCATT
AAGGTGTATTATTCACTACAAATGATTAGTTTAATGTGTTCTTTGTATCATCTCTCTGGT
GTTTACACTAAAATATCTCATGGAGGAGCATAAACCACTTTGACTGATTTGGCCCAGAAT
ATTCATCCATCCAAAAATAAAATTAAGTCGTGATATAGCTAAGGAGTCGTTTGTTCAGGT
TTTAAAAGCTAGAAAAATGCTTGGAGCTAATTAGTTGATGTTTTAATGCAATAAAATGTT
TTTGCTGTAGTTGCTAACGCAATTATTTAGCATCTTGTATGCATGGACTGCATAAAGGGA
AGAGGACGTAGTCATGGTGATGTCACCTATGGGTTTGTGGACCGACGTTATGAACACTCG
ACTTTGGTAATCCTGCTGTCGCCATCTTGAGATTTCTCCAATCCGTGGACAGATGTTACC
AGTTATTGAAATGTGGGGAAGGGACAAAGCGGCAGCGACCGTTCAATCACAAGAACGCCG
TAGGTGAGGAAGCCGCCTCGCTTGTGGGGTTAGATGGACAGCTGGAGGGCAGCAGCAGGT
AAGCTGGGGCGCAGAATTGACCAGCTAACAAGACACTGCCTACCAGCCGCCCACATGAGG
AGAGCTGAAGAACATCTTGTTCAAGCTCCTTGTTGCCCCCAGCTCATTTGAAAATATTGC
CCGTGGCCTAAAATGAACTTAAAGAATTGAGCTCCTGTGCAAAACGCTGCTTTTTCTGAT
GCAAATCTACGAGTCGGAGCATCCGGAGGAATGAGTCATGCACATAAAGGCAAATGTAAC
TGTTTGGGTAGCAGAGTAGAGTGAGCTGGCACAAGAAACCTCAGCTAACGTTACACTGCC
GCCCAACCAGTCACCGCACAGAGGACAAGGTTGGACCGAATGTCCAATCCAAAAGGTTAA
CCACCAAAATATAAACAAGCTATTTTATTCTATTTTTCCTTTTACCTGTTGTACTATGGA
TCGACCCAGACTGTTGCTATGAGTTGCCACAGCAACGCCTGTCGAGAAAACATAACCCAA
CAATGTCAATTACCAGCGCCGAAGGTAAGACGTTGAAATATATCTGAATTTTGGGTAAAC
TGTCTTTTTTTAATGCTTGCCTCATTTACTATTTCCTCTCCTGACTGTATTTCTGGGGTG
AGTGACAGGCGGAGAGGTGAGTTCAGTAGCAGCAGGGAGGAGTGTAGCTGATAGCTGTCA
ATCAGATCGCACAGCCAGCAGCAGCACTGCCGCACTGTCACCACCATCAGAGGCCTGACA
TGGAGGAGGTGGATGCAGCCACTACAACGAACTCTAAAATGCAGACTTCCACCTTTTTCC
ATCTTTCCTTGAAAGGTTAAAATCTTTCTGCATTATCTTTATATTGCCCTGGTTTTATAA
AACGATCAAAGTTCTGCTCATTATAAAACACTTTTGTCATATCGAAGACCTTTAATTTGA
AAATACTTTTTACTCAACCGACCTCATTTAAATGGTCTTATTTGAATAAACCCTCATTAA
GGAAGTCAGCCATGTGTTTAGAGAGTAAACAGCGTGGTGAATACAAAGCTATAAAGCTTG
TCTTTTAATCTTTTTCTCAGTATTACTCGATAAATGTCTTACCCAGTCGTTTGCTGGTCC
TTCTGCCAGGTTCATCTCCACCTTCCATGACTTGGTCATGACCGGTTCCCCCGTCGTCTG
CTCGCCCGGACGCACTCGGCTCCATAAATACTCTCCATCGGGCGGACGGCGGAGCGGGAA
GACTCGTTGTCTGCTCTGCTATTGGTGCTTTGTCTCTTTTTTTTTTTAATTAACTCGTCC
TTCACTCGGATTCTCTCCGCGTCCTGGTTTCTAAGGGAAACAAATAGAAAAAAAGAAAGC
GCAAGAGCACCGCGGTAATGTTTTAAAGGCGGAGGCGGCAACATGTTACCGGTGCATGAT
TGAATCTTTTAACTGACAGGCTGTTTAAACAATTAAACATCTATATAAAAACATACATAC
ATATTTTTAATGAATTGCAATAGAATATGACATTGTGCGTAAAGTTTTTAATTTGAGTCA
TTAGATACAATATTTGTATTGTAACAAAAACAATATACAAACTAAATCAATTGAAGGATT
GTATATTTTTTATTTATTTAACGTAAGTAAAGTATGTGTTACATTTATACAGCGCTTACA
CTATAACTAAAAACCAACGCAAAAGACATATTGCTATAAAGTGTTTTGAGTGTTTGCGGA
TAACCTCGTCTGGAGGACGAGCTGTGGCGCTAAGTGGGCCGAATGGGCACGAGCGGCGCA
CGTTCGCGCCACCTGCCACGTCCATATGTGCTCGCTCAACACGGCCTCGAGCCCGCGACA
GGGCGACAGGTGCGCGCTCTCAGAGGCCACATCGGTAACAACAAAGGGCCACGCTGCACC
TGTAACGCGTTCAAATGAGCAGGGTCCCCTAAATTATAGTCTATCCGTGTTTCACCTTAT
GATTCTACCAGAGGGAGACTTCCTGTCCACGACCTCCTGCCATTGAGTGGCTTATTCTTC
TTCACTGTTTCTGGCCATCTCATGCTTTCCCCATTCATTACTTTTTAAAAAGTGGTTTAT
TCCTTAAACGATTGTGGCTTTTCTTCAAACGTCTCACTTGTAAAAGAAAAAGTCTCAAAT
AAAATGCAGACTAGGTGTAAGTGATATGTACCCAGAGGTCTTTCTAGCAGCACAGTAGGC
TACTAATGATTGTGGGGTTTTTTTTACTCTTTTCCCGCGGGGCTCAGTCTGGTTTGCAGC
CTCCCTGGAGGTTTGGCTTTCGTCACCTTAGTAACTCATTGTCTCCGTGCCCTCCGCCCC
CTCTCCCTTTCCCGCATTGTCCCCCCGCAGTTTGGCGGTACCTTAACCGGTCAATTGTGT
CACGAGCAGCCTAGGATTTGTTTGCAGAAAAGGTGTCCGTGAAGGTTTGGGCGATGGACA
AAGCGGCCTGCTGGATTCATACGTTGGCAGCAGGAAGTTAAGGGTCTAAACCGCAATGCC
AGTTGTTCTGGTTCAGTAAAATGAACAATATGTTCTCCCTTGCGATGCATTTTGACTAGT
TACTTTGCATTGTGTCTTGGTAAATCTTAGTTGTCTCAAAATATTTCCTCAACAATGAGC
AATCACGTGTGAAATGATCAGAATATTTCCAATTTACATGGAAATGCTTTGTGTACTGGG
AGAAGAAATTAGTTTTGTTCATCAGGGAGGTTTTTTGGCATGGATGCTATTTTGAGGTAA
ATTGTACTTACTACTTTTGCTTACTTTACATGGACATGCAGATGTACATTTTTTCAATTT
GTACATGTAATGTTTATTACAACACAAATATTACTAGATAATAATACTAGATACAGATGT
GCATATCATTTTTTCTGTATACCAGTATTTTCCCGGCAAACATACAGTTTGACAAACTGT
TGAAGTGGCAATCTAACAACCTCAATACATCATACACAACTGAAATGTTTGTGCAGTAAG
CTGTCAGTTATATGAACAAAGCATGAGGAAAACATTTTGTATACTGGAAACAGGGTTGAA
AACACCGTAACATTTTGAGGAACGCTCTCACAAGAAAACACTTTTCATTTTGGTGCCTCA
TTTCCTGACTTGGTTTTAGAGCAATGGTTACTACATTTTTCCATATATGCAATGCATGTG
ATGTCCCATTAAATAATGGTTGGATGGAGGATGGATGTATGGATGGAAGGATGGACAGGA
TGACCCATGGGTGAAGGGACTGGTGGATGGATGGGTGGATGGTGGTTGATGGATGCTAAA
CATAAATAGATCAATTGATGGAGAAATGATTGATCGATGGATGGATCCATGAAGGCATGA
TGGAGGGGTAATGGGTAGATAGACGGACGGATGAAACGGTGGAGACGGATGTATACGTAC
TAACAGGTCTGTGTTTGTCAGACCTGCATCTCCTTATCAGGCCATTTATCTTGGTTACGT
TGGGGTGACAGGAGCACTAAATGGTGTCGCGGCGCTGCCTTCCCTGCTCTAGATAAAACC
GGTTTCAGCAGTTTAAACTGGGGTACAACCTGAGGTTCATCATTGTCCCGTCTGGCCCAC
CTCAAATAAACCCACCGCTTAAGCCCTCAGCACTGAGGTTCAAGGAAGATTACGTGAAAA
ACACACAAATATAAATTCCATCATTCTATCACTTTTCAAAGTAACTTGTAAAAATCTTAT
TTGTATTCGGCCTGAAAAAAATGAACATTTCATTTTCCAAAACCAAGGATCTAAACAAGG
ATGTTCGCCATGCATCATGACTCATTGCCCCGGTTCAGCACACGGTCACTCAGACGGAGA
CAAAAGGGAAGGAAGTCCCTGTTCTTTTAAAGTCGGGTCACAAGGTGACATTTGTTTTGC
TGCTGCAAACAACACAACTTCTTAACAAAAAGCACTCCAACACAGTTTAAAAAAAACATA
ACTTTTATTTTCCCCCAAGACAAATCGTTTGGTCGTGAGGATAAACCTGACGGTGCTCCA
TTGTTTGGCAGGATCATTACATTTCGAGGCCTGTAAACAGAAACACAATGAAAAGTGGCA
GTGTCATTTCCTTTTGTCAGGTGCCACCTCTGACTGATCAGCTCACGGGCTACCTGGGGA
AGATCGCTGAATCATTTACAGATGTCCCTATAGATCTGTTTGTTAAGCATCAACACCCG
Chart Advanced