SelenoDB
Release 2.0
Chart Advanced
Sequence Report for SEQ00000676_2.0
Identity
SequenceIodothyronine deiodinase (DIO)
SpeciesEchinops telfairi (Lesser hedgehog)
DescriptionGenome -assembly-
Sequence IDSEQ00000676
Sequence release2.0
External IDNone
Gene SPG00000677_2.0
Annotation
Prediction method(s) None
OrientationForward
Toolbox
Sequence
>SEQ00000676_2.0 # Sequence # Iodothyronine deiodinase  (DIO) # Lesser hedgehog 
ACACTGAGCTGTTAGTGGAATCTATCCGTGCTCTGCAGTGTTTACTTGTTGCAAGTTGAA
TAATGAGCTAACTAGCTAACTTATAAATGAAGGGGCTCTGATTTGTATTCAGAGGTATCT
AGTTTACTATTTTAACTATCCTTATTTAAACGAAATTCAATGATACAGCTTCAGTATCAT
GTGATATCAACTGCTCATTTTCCTGTGTGTCTCAAAGGGCTCTATCTGGGCTGGTCCCAG
TTCACACATACAGAACGCACTGCTGAAAACAGGTAGATCGTAAAGCTATGCTTTTTTTTC
TGTATTTGATGAGAAAGGTATGTTCTCAACGATGCCCAATTGTATCTATTACTTTTGGTT
TAATGCCCACTGATTCATACTAATAAATATTTTTAAAGTTACCAAGTTTGTCTTATTACT
ATAATATTAAATAGGCATTTGTAAGTACAACTTTCTAGGACTAAAGAACAGTGGTTCCTC
AGAAAAACGTGTACCTAACATAGGAAGACATATGTAAATGTGTTTGTCTGGGTTCACTAG
AGAAACAAATTCATAGACATGCATATGTGTATCAGAAAGAGCTTTATATAAAAGAGTAAT
TATATATCAAGAAAACATCCCAGTCCAGATCAAGTCCATAAGTCTGATATTAGCCCATAT
GTCCAATACCCATCTACAAATTCCTCTTCAGACTCACGCAACACATGCAATGACGCTGAA
TGCAGGAAGATCACAGGCCAGTGGGTGGAAAATCTTGTGGATCAAGTGGTGGTGGAAGTA
TCTCAGCACAGGTGTGGGTCTCCACGTGGCTCCTCCAGCTCCAGGGCTATGGCTCCATCA
GTGTAGCTGCCATGTGGCTTGTCAACAGGAATGTCTCACAGGGAGAGTGTGTGTGTCCCA
CCTCCAGCAAGCTATTTATCTCTTTAAGGCCTCCAAATGAGGTCATCAAGCTGTTACCTG
ATTGACAGGCTAAACTCTCCTTCACTCTTAATAGTCTCAAATTGACAACAGATTATGTAA
CTACCACAATAAGTTTTGCAACAGCACAAAGTTGTCAGACAATAAGGAACCAGAAATGCA
ATGTGGCAAAGCCAAATGTCTGTTAGAAAATGTAAAGTATGTAATGAATCCTGTTTATGC
ATGAGCCCTCAGAGCCATGCCTAGTAAGCACTGTAAGCTGAAAGCCTGCTGAGTGAAGCA
AGGTGGAGAAATACAAATACATGTAACCATACACAAAGCAATTGTATGTGTTGCTTATGA
ATGTTTATATGTGTGTGATAAAAGATTTAGAAGGAAACACATGAACTTCCTTATTTACCC
ATCGCCAAGTCGCTTTTCAACAGAGTTGTATATACATCATCACAATCAGTTCTGGTGCTT
TCTCTCCCTTCCCATATTCATTATTTGCTCCCTAATTGCCCTCACCATCCCCCCACACAT
CCCCAATAAACCATTGCATTAGTTATTGTCTCTCTGCATCCACTTCTGTACTGCATCAAC
TGGGAATCCTATCAGAAACAATAAAAAACAAAGAAAAACAAAGAAAATAATAATGAAATG
AGAGAGTAAGAAAGAAAAGACCACCAGCAATATTAAAATAAGCCAGAGAGGACTTTTTTT
TTTTTTTTTTTTTTTCATGGAAGCAGTGAGAAATATTTACAACTAGAGTCAAATTCAGGT
TGGGTCAAGAGGGAGATCAACTGACCAAGAAGTATCATACCTTAGTTCCATCCACCATAA
TCAAGTTGACAATAATCTCTGTCTGATAGCAAAGTTGTTCGTGGCCCGAGGGTCCCACCT
CAAAACATTTGCTCTCCATGTAAGCCCCTGGCATCAGCTCCTCATTTTTTCCCCACTGCC
TCTGCTACCCACTCCCTCATGAACCCTTGATAATTAATAAATTATTAATTTGTCATATCT
TACACTATCCGATGTCTCCCTTCACCCACTTTTCTGTTGTGCATCCCCCAGGGAGGAGGT
TATATGTAGATTCCGGTAATCAGTTCCCCCTTTCTACCCCACCCTCCTTCCACCCTCCCG
GTATAGCCACTCTCACCACTGGTCCTGAAGGGATCATCCGTCCTGGATTCCCTGTTTCCA
GTTCTTATCTGTACCAGTGTACATCCTCTGGTCTAGCCAGATTTGTAAGGTAGAATTGTG
ATCATGATAGTGGGGGGAGGAAGCATTTAGGAACTAAGGAAAGTTATATGTGTAATCATT
GCTACACTGCACCCTGACTGGCTCGTCTCCTCCCCACGACCCTTCTGTAAGGGGATGTCC
AAATGCCTACAGATGGGCTGCACTCCCCCTCATTTACAATGATGTGATTTTTTGTCTTGA
TACCTGATCCCTGATCCCTTGACACCTCGGGATCACACAGGCTAGTGTGTTTCTTCCCTG
TGGGCTTTGTTGCTTCTGAGCTAGATGGCTGCTTGTTTACCTTCAAGTGGTTAAGACCCT
AGACTCTATATCTTTTGATAGCCGGGCACCATCAGCTCTCTTCACCACATTTGCTTATGC
ACCCACTTTGTCTTCAGTGATTATGTCGGGAAGGTGAGCATCATGGAATGCCAGTTTAAT
AGAACAAAGTATTCTTGCCTTGAGAGAGTACTTAAGTGGAGGCCCAATGTCCATCTGCTG
CCTTAATACTAAACCCATAAATATATGCACATAAATCTACTTCCCCACCCTCATATATAT
ATTTACATATGTACATGCCTTTATTTAGAACTCTATAAATGCCCTTTGCCTTCTAGCTCT
TTCCTCTATTTCCTTTGACTTTCCTCTTGTCCCACTATCATGCTCAGCCTTCATTTGGGT
TTCATAATTCCTCTCGGTTATATTACCCTTGATCGCGTCCTACCAGGTCTCCTACAACCT
CCTCACCACCAATTTGGATCACTTGTTGTTCCCTTGTTCCTGTGTTTTTTAGCACCACTT
CCTTTCCCCCCATCTCCCCTTCTCCCAAGTCACCCCGGAACTGTCGGTCCCATTGTTTTC
TCCTCCAGATTGTTCATCCAGCCTATCTTATTTAGACAGACCTGCGGAGATAATAACATG
CATAAAAACAAGACAGAGCAAAACTAAGCAACAAAAGAAAACAAAACAATGACAACAACA
AGAAGCCAATGACAAAAATAAAAAACAACACAACAACAACAAAAAAGAAAAGCTTGTAGT
TAGTTCAAGGACTGTTTGTTGGCCTTTAGGAGTGTTTTCCGCTACTGTTTTGTTGCACGC
CCTTAGGGTTTTGCCTCGGTGTGGTGGGATCAGATCGGGCGCAATTCCCACACTGTGTCT
CCAGTGTTGTCCCCTGTAGGGCTATGGGTCAGTGAAGGATGTCGTCGTCATGTCTCATAG
TGGGGCCAGCCATATGGTCTGCTCTGTGGATTGGCTGCTCTGAGCGGGAATATCATTGTC
AAGGCGTGGTGGGCCAGAATGTGCTCCACTCTCTGTTCCTCCCCCTTCATTTGCATCCCG
TGTGCTCTGATCAGAAATGGTCCTCTCTCTGAGCTCAGTGCTGTCCTCTGAAATAAATTA
TTCTGGGGGGCGGGGGCAGCTGGTCCTTATCGTTGGGATGGGGGCGGCCCCTGCAAACCT
CTCTACTGGTTCCCTACTCCATGCCAGCATGTTGCAGTCACATCTTGGAGCACCATGTTG
AAGTCTGGTCCCTCTTTCCCTGTGGGTTAGTGCCCTGTGCCCCCGCTACCCATTTCTTTT
TTTCCTCCCCCCTCTCCTTTTTAGTTGGTTACCATATATATCCCTGGATTTGGTCTGGCC
CCTAGGTCACAGGTTTTATAATGCACTAAGCTACATAAATTTGTTTAAGTGGTGATCATA
ATGGTACTTACTTCATCGTTGTAATATATGTAACAATGCATATGAATGAACACTCAGCCC
AGCCTCCTACCCAGGTAATCACCCAGGTGAAGCAGTCATGAAGTGCTCAAATTGTGAGGA
CAGATTAGGGGAAATCAACTGTAAGTGCTACACAAATGAATGTTATTACTCCTATTAAGA
TGTTAGGTTGGCAAACTCTTGAGGGTATGGATGCATCCTTCCTATGAGGCACATGAAGTA
TATATGAAGTGTGAGAAGTGGAGGTAGATGGAAAATTGAAAATGGAAAGTGATAACGTTG
GCACCATGGAAGAATTGAAAATGAGACCAGACCATCCAGAAGAGATAAATGAAGACAACA
CTAACGGTATGGGGGAGGGATGAGAATCACCTCTGAGACCTAAGTAGTAGGGAGCCAGTA
GTACTGAACTCAGAAAAGAACATTTTATTTAGAAACCAAAAACTTTACGTAAAAGATACA
TATAATCCCATGTTGCTTGACCTTTTCTTGACTATGATCATTCAAATTACTACATCATTT
ATTTGACTTCATTCTCAATCTCTAAGACTATCAATTTTCCTAGAATTATATGATTAAGCT
TTTTGTTTCTTCCTTTAAAATTTTATTTACTTTTTTCTTTAGAAAGTCCATTACATATTA
TGTCCAGCAATGTGGATCTCCCAGTCCCAGAGCTCTCAGAGCCAACCCAGGCTGAGGAGA
AGGCTTTGGCCCCCAAGATCACAATCACCAACATGCCCAATGCATCCGAAGTGCTGCAAC
CTGCAATGGAGACCCCCCCAGAGGTAGTCGAGCCCAAAGAAGGCAAGACCCCAGAGTTCT
TAGAACAAACAATCCAGTCCATGGAAGGTGCCACTCTGAAACCTTCAGAACAAGCAATCG
AGCCCATGGAAGGTGCCGCTCTGAAACCTTCAGAACAAGCGATCGAGACCATGGAAGGTG
CCGCTCTGAAACCTTCAGAACAAACAATCAAGACCATGGAAGGTGCCGCTCTGAAACCTT
CAGAACAATCAATCAAGACCATGGAAGGTGCCGCTCTGAAACCTTCAGAACAAGCGATCG
AGACCATGGAAAGTGCCGCTCTGAAACCTTCAGAACAAGCGATCGAGCCCATGGAAGGTG
CCGCTCTGAAACCTTCAGAACAAACGATCGAGACCATGGAAAGTGATACATCAAAGCCCT
CAGAAGAAACAGCCAAGCCCCTGGAAGGTGATAAGGTGAAGACGATCCAGAGCAAGGAGG
ACTTTGAGGCTAACCTCAAAGAGGCAGGGGAGAAACTGGTGGTTGTGGACTTCTCGGCTA
CCTGGTGTGGACCCTGCAAGGTAATCAAGCCATTGCTCTACACCCTGTCTAACAAGTATG
ATGATGTGGTGTTCCTTGAAGTGGATGTTGATGAATGTGAGGAGCTGATTAAAGACTTTG
GAATTGTGTGCATACCAACCTTTCAGTTTTATAGAAAAGAGAGAAAGGTGGGTGAATTTT
GTGGTGCCCTTAAAGAAAAACTGGAAGCAGTTATTTCAGAATTAAAGTAATTATGTATTC
TGAAAACACTTGACAGCTGGCTGTTTATAAATTGTTTTTTTAATTTTACTTACAAAAAAA
GATCAGCTATAACAAGAATATAGGTCTAAGCATCACCTGGTTGTAAATTATATTGATTCT
ACCTTTTTCCAAAAATAATCAGCATTCAGCATAATGTAGCAATATTTTTGCTGATAAGGA
ACGATGACATTAGACTTGGTTTTACAAGATTTGAACTCCCACTGTCCTTTAATTTTCAAA
CTTGCCTTTCCATTCTTCCTTCAGAATTCAGCCCATGTATACAGTAGCGATGGAAATTTA
GATAAATTCTCCTGCAGACATACAGATTTAGAGAGAGCTTTTTTCCTTTTCATGTTTACT
TGTTTTTGGACTTACTGGTAGGACACCTTTTAGAAACTATAGATTTTGAAGACTCACGCA
TCTTATCTGGCCACTTCCCAGGATGGGGAGTACACTGAAGGCATTGAGGAATTAATGGTT
CCTCCATCCTTGGATACAATCTGTGGGTGGTAGTACTGGGAACAGGGTCTTATTCCCAGA
TTCCAAGTGCAGGGCTCATTTTATTAATCTATGTGCGCAAAATCTGAGACAGAGCTTAAA
ATTTCTGGCCAATAACTTTATAAAAGTCAGTATGACTCTTGGTGCCATTGTGACATCAGC
TCCCTGGTAGCAAAGTTCTTTCTTTGTCCAACTGGTAACTGGTGGTCTTAATACTTGTTC
CCATAGCCCATGTCAGTAGCTTGGTGAAGAGTGTTTTTAAATTTTTTAGTTAGTTGACAG
CATTAGAAATGTTTTTCCATTATAATCTAGATCTATAGCTTTAAAAAAATAAATTAAAAA
ATCATTTTATTGGGGGCTCATACAACGCTTATCACAATCCATACATACATCCATTGTGTC
AAGCACATCTGTACATTTGTTGCCATCATCATTCTCAAAACATTTGCTTTCTACTTGAGC
CCTTGGTATCAGCTCCTCATTTTTTCCCTTCCCTCCCCGCTCCCCACTCCCTCATGAATC
CTTGATAATTTATAAATTATTATTTTGAAAAATCATTTTATTTTGGTTACAGAACAAATT
TGTTTTCCATTAAACAATTCACACATTTTGTTTTATGACATTAGCTGCAAGTTCTTCAAT
GTAACCATTTCCACTTTCTCCTTGAGATCCCTATTTCTGTTCACCACACTTTCTTGACTC
TTCTTGTCTTCTGAACTTTGCTTTTTGTCAAATGTTGTTCTTTTGGTCTCATATGGTTGG
TTTTTTCCTAATGAGAACAGGTACTATTCACTTTACAGGCTTGGTCACAGTTTGGCTGAG
AGGCGATCTCTGGGAGGGGGTGAAATTCCAATTTTGAAGGCTCATCGTCTTGAAGGGTCC
CACCACTCTCTATTAGACTAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Chart Advanced