SelenoDB
Release 2.0
Chart Advanced
Sequence Report for SEQ00000652_2.0
Identity
SequenceGlutathione peroxidase (GPx)
SpeciesDrosophila melanogaster (Fruitfly)
DescriptionGenome -assembly-
Sequence IDSEQ00000652
Sequence release2.0
External IDNone
Gene SPG00000653_2.0
Annotation
Prediction method(s) None
OrientationForward
Toolbox
Sequence
>SEQ00000652_2.0 # Sequence # Glutathione peroxidase (GPx) # Fruitfly 
ACATGCGGTATGCAGTTGCTCACCGATGGCAGCCCTGCCCTAGAGGGCGTCCCAGTCGGT
CTGACTGTTGTAGACCTCCTCCTCCAGCCAGACCGCGTAATTGGCCTTGAAGTAATCCGT
CAGCTCGACCTTGCGATCCCACCAACCCGAGTGACCGAAGAAGGCAAAGTCCGAGTGGGT
AAGGATCTCGTCGCTGGGAAAGCCACCCTCCACACCATAGTCGTTGAGCTGCTGCTGCTG
GTTGTGGCCGCCATTGCCACCGCCACCGTTGTTTCCATAGCCATTTGCGTCGCCATTATT
GCCACATCCATTGTTGCCCGCCATCATGTTGGATTGCTGGGCGTTCTCCGCATTCTGAGC
TGCCGTGCCGTTGTTTCCACACTTCTGGGTGGCTTCCGGATAGCGTCGCAGGTTGAATCG
ATCCACGCAGGCCCGCAGCGTACACTCCTCCGCCTGGAAGTCCCAGGGACGCGACTCCAA
GTCGTTGCCAAAGGCCCAATCGTCGTTTAGACGATGCCGCACCTTGGCGTAAATTGCACT
CATGGTCTTCATATTGGACTTCCGCCACTGGCGGCCCAAGTACTTGGTCTGCATCTTGAG
CAGCTTCAGCACGTACAGCTGCATCATGGCGTGGCGCACCTTAAGCGTCTTCTTCAGGAT
TGGTGCCGACTTGAATACCACCAGCATCATCACTCGCGAGTGCTTCCACTTGATCAGCTT
GTTGAGGATGCGCAGCAGGTTTATGCAGGAGAACACGTTCCGCCAAGAGTAGGACTTATC
GGACATCTCTCCGCCATACACAAAGCTATCGCCACTCAAATCCGGTTGCTCACCAATCAC
ACACGACGGGAAATCGAGCAGAGGAATGGAGTTCTTGGTGTTCACGTACTCCGTGATTGT
CTGATTGAAGAACTTCAAAACCAGCGGGATGCAGTTGGCGAACACGAGATGCTGCGACAT
GAACTCAAACTGGTAAACATGGTTTATCTTGAAATGCTTTAAATATAGCAGGATGATGGC
CGAGACAGCCTTCACAATGATCTCCTTGTGCCGACCAATGTCGACGGTTAGCTTTGTTGA
TTGGGTGGCCGTCAGCGGCATCTTCCTAGGCAGCACATCGGCCATTATGTTGATGCTCTC
CGTCTTGGACTTGGACGTTGGCGAAGCTGCCAGCAGGACCTTGAGAAGGGCGATCATATA
CTGCGGCAGGTTTGGCAGGATGGCTTGGTACAACACCTCAGCCGGGGTCAGTTTGATTTC
GTCCTCGTGCGTGGAAATGGGGTTCCTAGCTATGTCCTCCTCCTTCTTAATTTGCACATC
GGCCAGGCTCATATACATGTGCCGCTGCAGCGTCTTAAAGCCCTCGTGAATGGGTTGCGG
CAGTCCAGCCAGACTCTCGTGGTCACCAATCAGTGAATACCCGATGAACTTATTCCGCGA
AATGTCCAGAAACTGGTCAATGTCCTTTTGTCGCACCTTAGGCGTCCAGGGCAGGCGAGC
CGTGATCTGTACCGGAGGCACAGCAGCGGGTGGCTGTGTTAGGCTAGGCTGGTTGTTTGG
ATTTGCCGTCGAGGTGGTGGATGCCGACGAAGAGGGGTCATCGTAGGGTCGGTAGTACTG
AGAGAGTTCTTCCTCCCCGTTTCCGCCATTGCCGCTGCCATTGTTGGCATTATTTTGACC
CTCGTTGCCGCCCATCTCCATGTCTATCTGCTCGGGCTCGTCCAAAAAACGCTGCTTCAT
CAGGGAGCGTCTGTGCGGCAAGGAAAATGAATGTATTGAAAAGTGTACATAAGTGATCTA
AGACTCCGCTTACTTGAAGTTCCGCTTGGGATACTGGTTCTCCAGTATATCAGTAGCTGT
GGCCGGCGGTGAGCTGGCTCGCATGCACTTGGTAACCTCCAGCGTGTCCTCGGTGATGGG
TTCCAAACCCACCTTCAATCGATACTCGTTCTTGAGATTCTTGAGCACATCCATGCCTCC
CAGTCCCAGCAGCGAAACTTTCCACAGCAGGAGGACAACCTTCTTCATGGGGAACTGCGG
TGCTGCGCCACTGCAAAACCGTGTGATCATGCCCAACAGCTTGACGGCCAGAAGTTCGCC
ATCTGGTAGTGGTGAGTTGATTTCTTGCACAAAGGAGTCGGCCAGCTCTCTGTAGTCTTC
GCTGCCCTTTTCCTTTTCATCGCGAATCGTTTCTGTGATGATGTAGAGCACAGATAGGAT
CACCCGAATGTCCGTGGAGTCCACAAGCGTGACGTTAGTGATCTTGACGGCCACAATGTC
CGGAGAGCAGGCGCTTTCGATCTCCATGTTGAGCAGGTCGATGAAGGAGGCGAAGACGCC
GAGTTGGTAGAGCACCAGCACATTGTCCCTGGTGATCTGGTGCTGCTCCTCGTCCGACTG
AACCTCCGCCCAGCAGCCTTGGGCCAGGTAAAGGATGCACCGGGCGGCCTGCATGCGAAA
GGATCGATCGGAGACCTCCAGCTGGTCCACCAGCTTCATCACGATGCCGCGCTGGGAGGC
GGAGTCCTGCTTCTGCCAGTTGGGCGGCAGGTCGTACAGCTCCATCTGGTCCTCGAAGGC
CTTCACGTTCATCTGAAACTCGCTGAACTCCGTGTAGCTATACAGTTCAGCGATCTCGTT
CTGATAGCCATCCACGTCCGCGTACACGAAGTCCAGGTCGGGCCCGTCGCAGTTGGCGTC
CGCATCGTGGGTGTCCTGCTCAAAGGAGTTGTTTATGGATGTGAGCATCATTCCGCCAAT
CCTTTTTCGCCACACAGGGATCTCTTTTGTGTGGAAGTGTATGTGCGTGAGTGTGGGCTA
CTCGTGTATGTGTATCCTGCGGCGGTGGGCGGTGCGCCTGGCGTGGGCGTGGTTGCTCCT
GCTCGCTGGTTTTCTCTCCCACTTGGTCTTAGTAGCACATGGACGTACTAAGCAATTCGC
ACTGCATTTCACTGGGTAATTTCGACTGCAATTTGTTTCTCGCCAAAAACAAAAACGCAC
AATGGAAAAAGAAGAAAATTCGTACGACCGTTTGCTGTGTGGTCGGAAAATACCAAACAG
CAAATGGTGTTGGCCGTCTGGCAAGGCCGTTCGATCGGATGTGGCAGCGACTGATGCAAT
TGCCGCTGCTTTAAATTTGAAATAAGGGTTCTGTTTGATTTGTACTAATATTAGGAATAG
GGATTGTTTCATTTTGATATTTTGTGTTTACAAAATGATAATCAATAGTAATGATATATA
CAATTTGAAGCTCTAATTAAAGGCTTTTACTTTCATGCTTAAATTTAGAAAGTAGGGCTT
AACCACCACACTTGGCAACTCTGGAAAAGTTGTGCTCCTAGTGTGACCAGACCAGAACAT
TACAAGTGCTTTCACCTACACATATAAATAAGGGTTTTTGCAAGTCGCCGGTTTCAGTTT
TATTTACGCTTCGAAAGTGAGAAAGTGCCCAGTTCCATTAGTCATTGCTATTACGCCATA
AGTAAGCCCAAACAATAATACCCAGCTGTCGAGATTAAGCACAGCATAATCAGCCCAAAA
ACACAGCTGGTCGAGGTGACAAGAATATATGTATATAGAGCAGGGAAAACAGTCGAATCG
AATCTGAACTTTGCTCCCGATTTTCGCCCATATCAGCGTGAGCTTGCAGAATCTCGGCAT
TCGCATTCTATATTTGTATCCCTGCATCCGAAACTCGCAGCAGATCGTTGTGAAATCGTA
CACATAGTCGATATATAGCTCAGTAATGGCTGGCCGCTCCATCGTCCACTTTTTTCTGGG
GTCCGTGGCAATCGCCCTGGGATCGTACATCTACTTCACCATGCAAGTAATTACCCACAA
CACTAACTATCCCTTCAAATTGCTGTCCAATCAACTCGAACAATGGCATGCATGTGCAAT
CAGCGACGGTAACGAGGCAGCGTCGTGGGTTACGTGGGCCAATCCTGGCCAGCTTAAAGG
TCACTGTGCGTAGCCACTAGGTTGCGTGACTCACAGGGTGCTGGGATATACATATATGTA
CATATAGCTCTTGACTTTGACCCCGATGAATTATGCAGCGTCACTGTAACCAGAAGCCTG
ATAGCACCCTCGTAAATGTCTATGAAACAACATACAACTATTAGGAAACCCATTATCAAA
ACGTGAAATAATCTTGGATGTTTGTCGTCGGGTTGTCGAATACAATCTATACACCACATA
CATTTCCACACTTTCTTATTCGGAAATAAGATAGCTTTGAGCTATCTTACTACTTTACTT
ACTACTTGCTCTTATCTACTTAACTATTTCGTTAATCAGTAGAAATGTGGACTTGATTTT
TATATTTTCCCATTTGAATTGTTTTGAAACGATTGTTGTTCGATCTGATACACAACGTAC
ACATCCACACCAGTAATTCCTTCACTTGCCTAAGCTTTCACTAAATTTGAACATTCTGCC
CGGTTATTATTTGCAGCATTTAAAGAATGAGTCTCAGGCAGTTTCAGAACATTTCCCGCC
AGGCCCTCAGGTGCTACTCGATGAGGCGGACCCCTGGCCCCGTCCTCGAGCTGAGTCGCG
GTCAGAGGCAGTGCCTTCGCCTCTGCACCATCATGCTTCCCGTGAGCTGTGCGGCCACGC
CCATGAACGCCATCTCCTCAGCCGCCCAGCACTCCACAGCAGCTGCCGTGAGTAGTGCTG
ATTGCTAGTTGACTAGATCCTAACCCGTTGACTAACTCAGTTGCTTGATTCTGCGCCTAA
CTAAACGTTGTAGCCTTTGCCACTGCCTGTGTTCTCTGTTCTCTGTTCTCTGTTGCCTGT
TCACTGCAATGAACCGCGTAGCCTGGGTCGATTTTGATACAGAATATAGTGTTTCATACC
CCGATTGAAGATAAGGCTATAAATATCTATATCTCTTGATCAAAACATCGACCCAAGCCT
TCACAGCCACTAGTAATTACCCAATTCTAACTCCCACTTTCTATTGCTTCCAGATCGACA
TGTCTGCTAACGGAGATTACAAGAACGCCGCCTCGATCTACGAGTTCACCGTGAAGGATA
CCCATGGCAACGATGTTTCCCTGGAAAAGTACAAGGGCAAGGTGGTCCTGGTGGTGAACA
TCGCCTCCAAGTGCGGCCTGACCAAGAACAACTACGAGAAGCTGACGGATCTAAAGGAGA
AGTACGGCGAGCGCGGCCTGGTGATCCTCAACTTCCCGTGCAATCAGTTTGGGTCCCAGA
TGCCGGAGGCCGATGGAGAGGCCATGGTGTGCCACCTGCGCGACTCCAAGGCTGACATCG
GCGAGGTGTTCGCCAAGGTAAGACTATTAAAGCTGCTAGCCGATTGCTGTAGACCGAGTC
ACTAAACTTGCCCCACCCCCGCAGGTCGATGTGAATGGAGACAATGCGGCGCCGCTGTAC
AAATACCTAAAGGCCAAGCAGACCGGCACCCTGGGCAGCGGAATCAAGTGGAACTTCACC
AAGTTTCTGGTGAACAAGGAGGGCGTGCCCATCAACCGATATGCCCCGACCACCGATCCC
ATGGACATCGCCAAGGACATTGAAAAGCTGCTGTAGATGTGCCCTAGACGTTAGCTGCTC
TTTTGGACTGTGTTTTCGCGTAGCTTTAGCTTGTAACCGTCTGGCCACAGATAGTCTTGT
GGCCGGCCACATGCACCGCATGGTATATATATTGTCTACTCCTTACTGGTTTTGATTCCC
ACCCGCAAACATAATAAACGCCATTCGTGGTTACCACACTATCACCTGGGTGTTTGGCGA
CGCCGGGCACGTACTTTGATCGGTAGTTGGAACTGTATCAATTCGGACTTACCGTGTCAA
CGCTGGCGCGTTCAATCCGCTTGCTGGAAGCAGCAATGGTGTTAAGCACGTTGATCCTAG
ACTGGATGGACTGCATCATCGAGGATCTGGCGTTTACGGCGCCACAGCTTAACTGGTTTT
TACAAGTGTCAAAAAGGAGTTTATTTTTCTGTTTCCAAGCCATATATATTTGTTAGGTGA
CTGTGAAATTTGGAGATGTCATATTAAGGGAAAAACGAAATTCACAAAAGAAAGGTATGA
TGTTTTCAACGGTAGAGCACAATTTTTGAAAACTTGTTCAACTTAATGACCACGAAAGCT
CGCATTGTTTTAAAACTAATTAATCTTTGAAAGGACCTTGATCAATTAGTCTGAGTTTTA
GATTTTAAAACCCATATTTGCCTTTCTCTATAATGATATTCAAAACAAGTTTGCTTTAAT
ATCCTTTAGATATTTTTGAAAGAAAAGTTACTTTTTCTGTGAGTAGGCAATATCTGTTTT
AAAATATTCCCCCTTACCAATTTGACCTTATTGGTGGTTACTTTAAGTGCAGAAAGAAGC
AAAAGTACTTCACATTAACCTTTACCTTCTTTCCGAATTCGAGTGCTCCGAGTGTTCGCC
AAATGCTCGCCAAACTTCGATTGCGCAAGTTTGCCTGACCAGCACCCCCAAAACCAACAA
ATGCGAATCCGTCAGCCCATTGGGGCGCCGATCTCGAGCTGCTCCTCCTCCAGTGGAGCA
GTTCAACGTCTCGGCCGGATTTCAAGTTCAAACCAGCTGCCAATGGAGCGGCGACTCCGA
CCTTCCGACAATTACATGAAAATGCTGCACTCACCATTTACGGATGCCATCGAAATTCGC
AGTGGAGATCAGGCGGAGAAAAACCAAACTGATGAGCTGGAGCGAAATTAAAGATCTCTA
TTGGATTAGCTTCTTTTACCCGAAAGAACTTTTCCCAAATTTTCCCAAGAAATTATTTTA
ATAAAATCGCATATTAAATGATATATCTGTGATATATGAACGAACTTAGGCCCCTTTTCT
CTCAGTGCTGGTGCGTGCCACACAAGTGTGAAGCGATGACAGCAATTTGTTGAATGCATC
ATCGCTCAAATGCGATCGCTCGAATGCCTTTAATTGTAGAACTAGGTTAAGCATCTGAGA
CTCATCCCTAAACAGTTTGGCCCAGGTCAGTAGCGAAGCTATCGAAGCTATTGTCGCCAT
AGTGTGTATGCATTGCTATTCCCAGTGCTGCAGTTGACTTTGACACTGATCGCGATCGCG
ATTGCGAATGCGATCGCTCCCCCAATTTTGATTCCGAATCCACCCAAAATCCGTATAAAT
ATGCGGAGCACACTCCACTATCGATCAGACAGCGGTCAGCTTTGGTGGTGGTCAGCAGTG
ATTGGACACACAGCTAGGATTTTTGACTTCGGATTGGTAACAGGATTAGAACAGGATGTT
CCGAGGAGTGCTGGTGCTCCTGCTGGTGGCCTGCAGCCAGGTGGATGCGGCCACCCATGT
CAACATCTCGATTGCACAGCAACCGGCCACAAATCCGGCGGATGTGAAGTACGTCGATGG
TATGGCTCCGGCCGAGCTGAGGGCGGGTCCTCAGAGGGATGAGGATCAGCAGTTTCAACG
CATCCAGGAGCGACAGCAGCAGGTGCTATCCCAGTCCCAGCAACAACAGCAGCAACAGGT
GTCTCAAACCCAGCAGCAACAGCAGCCCCAGCAGCTGTCTCCTCGCCAGGGATTGGGATT
GCAGCCGCCAGCTCAGGGTCAGTCACCTATGTCCAAGAACGGACGACTGCCCCGTCGCCG
GAATCACAGCCGACGCCCCTCCATCCACCAGCAGCCGCCGAGTCCTCATAGTGGCCAGTT
TCGACAGCGCAACCAGCAGCTCCGCCAGAACCAGGAGTTCGAGCGGTACATCCAGTCCTA
CCACAGCCATGGTCCCACCGTGGAGACGGTAAATGGAAAGAAAGTAACATGTTGAGCCAG
CAAGTTAACTACCTTACCTTCCAGGTCTACGAGTCATCGAATCCGTCCCCGCAGCGCTAT
ACTCAAACCAGCTCCGGAATAAGTTCGTCCTCGTCAGTGGACGATGCTGCTCCCCAGAAA
CTGGTGACGATTGGAGGACATCGGTCGCAGCAGCTCCGCATGTTCGAGCGCCAAGTTGCT
GCTCCCGTTGCTACCCAAGGACAGAGTGCAAATGTGGAGGCGGCCCAGGACAGCAAGCCC
ATCTACGAGCCCCAGCAGGCTCCCATTCAAACGGCCAACATTGCGCCGGCGGTGAGCTCC
AGTTCATCCTCCTCCTCTAGCTCCGTCTCCTCCGCATCAAGTCAACCTGCTGCCCCGGCG
CCCGCTCTGCCATCTGATACTTCATCTGCCTACGACTCCGCCACCAGCTATAATCGCCCA
AGCTACGATCCCAATGGCTTCAGCTACGAAGATGGACAGGAAGTGGAATACCAGGATCAA
TATCCGCCAGAGGTGGATGATGGCCAGGGGTACGAGGACTATGCCGATCCGTCGGGCTAC
CAGGGAGGTTCGGGCTACCTGCCGCCTGCTCCTGCCAGAGGCTATGCTCCTCCACAGCGT
CCCCTTGTCACCAAGACCATTCAAATAGTGCAGCCAGCTCTGAAGGCCAAGAAGTACGAA
GTCCGTCATCCAGCCATCCAAAAGGAGTTCTACGACATCGAGGAGCGAGTGGTGATCAAG
CCGGCGGGAACTCTGGTAGTCGAGCTGGAGCATCCGGTTGCCAAGATTCCCAAGGGAGAA
ACCCTGCTGCCTTTGGGACATCCCCATCCTGCAGTGGCTTCCGCCTACAGCAACAGCAAT
AATGGTCAAATCCAGTCGTCGACATATAACAACAATGTGCCCGAGTACAGGCCGTCCTAT
GATGCAGCTCCAGCTCTTGCCAAGGATCAGCAGCCCACCACCATCGGCTCCAGTGTGACC
ACAATGCCTTCCTACGATCAGCAGCCCAAAGATGATTTCGTGGAGTCCCGGCTGCAACAG
CAGCAGCCACTCGGAGATGTCACCGATGGTGGAAAGAGCTCACCCTCCTTCATATCCGGA
GTGGATGCTAATGGAAACGCCGTCAAGATCAACGCCAAGCACCTCTCACCCAAGATGATC
CAGCGTGCGGAACCGGAGCAGGATTACTCCCGATCGGGCCAGAGAGTCTATCAGCAGAGG
AACAACTTCAACCGCCAGCCATACAACCAGGACGACGACTACTTCTCCGGCGAATATCTG
CCCAATGTGAGTGCCGGCAGTGTGGAGGCCAAACCAGCGCGACTGGAGCTGGCGGAGGAG
AAGGAAGACGAGCGACCTACCCAGATAATCAAGCACGAGCACAAGATTCACTTGCCGCCC
TCGCAGCACAACATTTACCTGGGACGCACCAGCCAAACGCCCCTCAAGGAGCGAAGGATC
CAGGAGGTGCCCGCCCAGGTGACCGAGATAAAGCCCTACCTCAGGAACCACGTTGGACCC
ACTGTGTTGTATTCAAAGTCACAAACTCCCAGGACGTACTACAGCCAGCCATCCCGGCAG
CGCGTTGCCGAGGAGCTGGACTACAGTGCTCCCTACTCCCAGATGAGATTCAGCCCCGAC
AACCACTCCTCCAGACTCGTCCAGTCGCCCCAGGTGCGATACAGTACGGAGAGCCAGTCC
TCGCGGCTGGTTGAGGCACCCAAACCAGAGGAGCAGAAGCAGGAGCCAAAGAAGGAGCAG
CAAAACACCCACATCCAAATCCAGATAGCCAGTGACCAGGAGAAGTCTGCAGTGGTGGCC
ACCACTATTGCTCCGGACTGCGACAGGGGACAGCAGAGAGCAGAGCTGCGGCAGCAGAAG
TCCCAGCGCCTGGTGGAAGCACCCAGTTCCGAGGTATCCGCCACCCAGGCTACTCCGTCC
CAATCGAAGCCCCAGCCGGATGTGGACGTCTCGCTTAATGGAGCCGCTGGCCATCTGAAA
CCCAACGAGAGGGTCATCGCAGCAACAGCCGCGCCAACAGATGCCTCCGCCACCAGCGAG
ACCTTCCACAAGCGCCGCATCGTTGTCAATCATCCATTCCAGACGGTACGCGAAGTGGTC
GAGCACGAGCCCTTCACCAACTACCATCAGATTCAGGTGAACGAGCCGGCTCCGCCCTCG
CACTACCACCAGGCCTACTACCAACCGGCGCTGCAGACCCACGGGAGTTTGGTCCATTTC
CAGACCTCGTCCGCCCATGGCAATCTATACGGATAAGGAATTAGGATTAGGGAAGGATCC
GAAGTCGACCAACGAACGAACCCGGCCAATGCACTTCCTCTGCTAATCGTTATCTTAGTG
TTAGGCTAGATGCTAAACTTATCATGTACGCAAATCCGGTGGAAGGGCCCTTTCCATGAT
GACATGACCCTGATCTTCTTTCGCATTAATTTGTTATAAACGCGTAGGCTTAAGTGCAGT
TTTACTTGCCAACAATAAAGTGCATATATAATGCTAAAAATGATTTTCTCGTCTTGATTT
GCCATGTATATATATATAATATATCACATATGTATATGGCTATACAATTGTTATATAAGT
GTTTTGTTTTTGGTTAGGCTCAAGGCAATATATAGTTATATATGAGAAGCATAGAAGATA
ATAAAATTCGAAAATCCTTGAAATGCTTTGAGCTTTGCTTCTCTAGTTTCTTCAAATTTA
AAAAACATTCTTCTTACGCTGATATCGAAGGTTCCTCTAATGAACGCTTTTGA
Chart Advanced