SelenoDB
Release 2.0
Chart Advanced
Sequence Report for SEQ00000651_2.0
Identity
SequenceIodothyronine deiodinase (DIO)
SpeciesDrosophila melanogaster (Fruitfly)
DescriptionGenome -assembly-
Sequence IDSEQ00000651
Sequence release2.0
External IDNone
Gene SPG00000652_2.0
Annotation
Prediction method(s) None
OrientationReverse
Toolbox Forward Reverse  
Sequence
>SEQ00000651_2.0 # Sequence # Iodothyronine deiodinase  (DIO) # Fruitfly 
ATCTAAAAACTAACCACTGTGCTCATGCCAAATGGCGCTCCTCCTCGCAGATGGCACTGC
GCGTCGCCTCGCACTGGGCACAGTGCTTCTCCAGAAACTTCATGGACAAGTGGAACGTAT
ACCGGTGCCGGGTGCAACGCCTTTACATCTTGTACTCGACGATTTTGTTGGGATTGAGGA
ACTGCTCCCGTTGCGACGCATCCAAATGGGCTACGGTGCGCGTCAGTGCCGAGCCCGAAC
CCGATCCCGATCCCGATCCCTGTCCCTGACCCTGACCCTGACCCGATCCTGTTCCAGTTG
CTGATCCCGAGGAGGACTTGTGCTTGCCATCGCCGCCGCCGCCACTGGTGCGTCCAGTAT
CCGTGCCAATGGGCTGGTAAACGCCCTCTGCACTGATCACACCCACATTGACGCCGGCGA
CCACTGGCTGTTGGAGATATCCGGAATACTGTGGCGGCAGCTGGTAATTGCCCGGCGGCT
GCTGCTGCTGCTGTTGGTGGCTGCCCGCCCGCGGCTGCTCCGTGTGGGCAATGGGATACT
GCTGCTGATGGGCGTAGTCCTGGCTGCTGCCCACAGCGCCAGCGCCAGCCACCGAGCCGC
CAGCTGCTCCTCCGCCACCGGCTGATCCTCCAGCACCGCCACCGCCCATCCGGGAACCGG
AATCATCGTTCAGGCCCTCACCCATTTCACCATCCCGATTGCGCCGTCCGCGGATGCACA
GTTTGGTGAAGAGCCAGACTCGTCCGCGGTAAAGGAGGTAACAACAGAAGTGAACGAAGA
ACGTAAAGATGATCGCACAGGCCGTCACTATGATCGCCTTGCCCGGCTTGGTCCAGTCCA
TCATGGGATAGATAGCAGTTTGATTTTTCCTGCAAACACAATCGTCATTATCATCCAAAT
TTGATCAATCATTTTCAGTGCGTATGAAAATCACCTGTCTGTTCCGCCGGCCAAGAAATA
GATTCCCGTGAATATGGCGTAGGCCAGGCCAATGCCAGTGGTAAAGTAGGCGTGGCTCAT
CTTTATCGGATGCCCCACAATGGCCAAATCGATGAGCATTATAATCGTGTTGAGCACATG
GACCATTATGTTTAGCGCATCGATCTTATGGATTTCTGAAAGATAAAAGATGTATAAAAG
ATATGTTCTCTAATTAAATGGTTTCCCTTTTCTAAAGAACTCGATTAAAATGCACTTCGT
TCTATTCATATATTTGGCCCTGCAGGGGAGGCTTTTTCACAGGTGTCCAATTTAGGAAAT
CCCTAATCCATGAACATCTCCCACTGGCTCTTAACGGATCTGGACAAAAACTTTTGATTT
GCCGTCTGGCCAGCGTAGTAGAACTCAAAACCAACGTCATTGGCGGAGTCAAGAAAGATG
TAGCAGGCGAGAAAGTCGAACAGGAGCATCGTGGAGCACAGCGGCCTATCCAGAATTGGC
GGTAAATTCTCCCAATAGCCGGATATGACCTGCGCCTGGAACACAATCAATGGGCATATA
ACTTGCCAGAGCACAAAGTGGGTGGCTACTTCATAGGAGAATATCTGATCTGAAACGTGT
ACACAAACGGCGGCCATTAGGACGGAGGAGAGCACAACGAATATGAACCAAGTGAGGAAC
AAGTAGGCCATTGCAGGGCATTCGGGCAATAGATATGAGCCGACCAGCAGGAGCAGCGCC
ATCATGACAAGAATCTCCATGCTCAGCAGCAGGACGTGTCCCGTCCGCTGGTTTGAAAGG
ATACACACCGTTCCCAGTGCCAGACAGGCTGCTATGCAGCAGCTGACTATCCAGTTGAAG
GGGAACTTCCGGCGCAGCCAAGTGACGTTGACATAGACGCACAGGGTGACCAATCCGATG
ACAAAGAAGCAATAGGTAGCCACTACATCCGGAACCAGGAGGTATCGTCTGAACAGGCCC
GGCAAGATGAGCAGCCCAATGGCCAGGACAATGAACAGCGCCGCAATGCCGTAGATCCAC
TGGGCCACCTTGAGACGAAGGCGCACGACGCCATCGACTGGCTGATCATTCATCGATGTG
GGGGATTTCCTCGTTTTCTGCTTGTTTCCCGGCGCCCGTGTCAAGTGTCAAAGGCGACAG
TTCGGCCTGACAGCCAGTATGTTAAGTGTAACCAGATCGGCATCAGCCCCAAATTTCAGC
GTGCGATCCGTTGTAACCTATAGCTCCACGAGCCACTTCGAGGCAAATCATAGTGTGAGT
GATAGTCCGTTCTCGGAAGTGGATCGTTTTGTGGAGGCTGCCACCAGCATCAACCGTTTT
CCAAAGAGGCGGAAACTCTCCTCCTGCATTTTCCGAACCTACGTCTGCCTGCTGTTGGTC
ATCCAGGTCATCCTGGCATCGCTGCAGTGGCTCGGATCCACGTACCGCTGGAAACCGCAG
CTGAGTGCGGCCAACCGCGGCCTGTCCGTCCTGCTACTCCTGATTTCGTGGATCAACCTG
ACGCTGGCCTTCATGGGCTTCCGGCGGCTGCAGTTCACCTTCCCGCTCAATTGGATTGTC
TTTGGGTGCATCTTCGAGAGCCTCACGCTGCTGGTGGTATGTCTGCACATTCTGGAACAG
GACCTAACGTGGCCGTTTGTGCTAATTGGCATTGGCGTGCTGGTTGTCTATACGCTGCTG
GGGCTGTGGGTACCTGGATTCCTCACAGCCAACTTGTGGATCCTAATCCTGGCAAGCATT
GTGGTCTTCCTGGTCTCGACAGTGGCCTTGAGCGTTCGCCTGCAGATGCGATACTACGTG
CCCGCTAGCGTCTGTTTGGTTTTCTTCGGACCCTGGACCATGTACAACTCCCAGAAGTTG
TTCCTGCACCACAAGCGGTCTGGTTACGTAGCTCACCAGTATTTGGAGGCGTCCGCCAAG
ATGTTCATCAATTATGCCTTCACTGTGAGTGGCATTATATTTGCCCACCGCTTCTCGGTG
GACACATTGGATGCCCACAGTTAGGATATGGTGATTTCTTGGCTGCCATTTTTGTGGTTT
AGATTTTTTATAAGTCTTTCTAAGTGCTGTGCACAATTAAATTATGTGTCGCAAAATTTT
TTGTTATTCCTCAATTAAAACCCCCAAAAATATCATCGTGGAATATATTGTCTGAAGAAA
AATGTCAACTATAAGAAAAGGTACGTATTCATACTAGTTTTCAGAGCTTTGTCGTTTGAA
ACTGTAACTTTTCGCCAATATGGTTCACTTACCGGGATTGTGGACCAGTAGCCAATAGCA
CATGGTGACGATGAACGCATAGACAGTGGCACAGGTGTAGAGCACCCAGTACAAGTGGTG
CAGGCGGCTCTTCTTCGCCTGCCGCACAATCTCGAAGTCCTCGCGCTCCACCATCATGCC
CTGGGTCACTATCCAGGCGGCCAGCCAGGCCTGGACTGTGCAGAAGAGCAGTCCCCAGTG
GGTCAGGTAGATCCACCACTTGGCATAGTGGTGCTCAAAGTGCTCGTCCGTGCGCCCAAT
GTCCAGCAAGGAGCAGACCAGTGCCGCCAGGCAGGTGATGGCCGTTATCCATCGGTAGAA
CAGGTAAACGATGCGCACCTGCGTGTTCCGTTGCCACTAAATATGAGGAAGCTTATTAGA
TAAAGGATCTAGTTTTCTGAATAATCTATATGGGAAAATAACCATTCCAAGGTACAGATC
TATGGATCTGAATATGCTATGGCTCACCTGGCATAGGTAAAAGTTGTGTCGATGCACATG
GTCCGGGGTGAACTCCGGGAAGCAGCTGTTCCACAATTTGCTAACCATCATTCTCTGATT
GCCCAGGCAGCTGCCCGCGTTGGTGGCGAATTGGTTGAAGCCCTCGCAGCTGTCCTGCGA
AGGATATTGGTACGAGTGGTAGGACTGCTGCTGCAGTTGCTGCTGCGACGGCTGGAAGTG
CTGATGTTGCTGTGGGAAGTGCGACTGATGTTGCTGGTGATGTTGTTGCTGCTGCTGCTG
CTGATGATGCTGCTGCTGCTGCTGTTGTTGGTATTGGTAGGGCTGATATCGCTGGTCCTC
AAGGACACGCTGCGACTGACCACCACCACCACCCCGACCGTCTGATCCCGCCGATCCTGC
TCCTCCCGCTGCGGCTGAGCCGTGCTCCGTTTGGTACTCGTGTTGCGGCGGCGTCTTGTG
GCTGTGCAGGCTGTCCCGGCCGCTGCCGCCGTAGGGATGTAGAAAATCCGGCAGGTCAAG
GATGTGGGCCAGCTGCGTGGCAACCTCCTCGTCGTCTTCGTCCTCGTCCTCCTCCTGCAG
ATGGAAGAAGCGCAGTTCCTCGAGACTCGAGCAGTCCGTGGAGAGCAGTTCCTGCGGCAG
GCACTCCTCGAGCAGGTCCTCCTCGTCTTCAGTGGTGCTGGCAAAGCCAGGCAGATAGCC
GTAGTTGTCGTAGGCGTCGTACCGCCTGCGGGGTGTGGCCTTGTAGCGATAGCCAGCTTG
CAGCTCCTCCGCCGCGCTCCCGTACTCACGGAACGGCGAGGTGGAGACCGCTGATGCTGA
TGCCGCTGCTGCAACGGCTGCCGGAGTGGGCGGTACCGGTGGCGGAACGGTCCGTGTGCT
CCGGCTGCTGAAGTAATAATCGGTGGCTACACTCGGCGCCGGTGGCGGTGGTGGTAAGGC
TGCCGGAATGGCCAATGGTGGCAAATAGCCGGGTGAAGTTCCCGCTGATGCTAACAGCGG
TGTCGGCGAGGCATCGAAGTTAATAAGCGCCGCTGCCGGATAACCTCCTCCGGAATATCC
ACCCACGCTCCGGTACGGATACGGAGGATACGGTGCGCTGCCCGGTACACCGCCGCTGCT
GGTGGTTCCAATATAGATGTGTGCCGATGTGGACGGCAGATGGTACCAGCTGGAATGGCA
GAAGGATGCAAACTATAATCTGTGCTATTACTATTTCTATGTTTATGGATTTAATACCTG
GCTAGATTGCCGCTGCCCAGACCGAAGCCCAGGCCCAGTCCGAGACCCAGATCGGTGTTG
GTGCTACCGCGACTGAAGTAGTAGCTGTACTGCTGCTGCTGCTGCTGTTGTTGTTGTTGT
TGTTGCTGCTGCTGCTGGTGCTGCAGTTGCTGGTGCTGCAACTGCAACTGCTGGGCGGCA
AAGAGCTGCTGCTGCTGGGCAATCTGCTGATGCTGCTGATGGGGGGCTGCGTAGTCGGTG
AGCCAACGTTGCCGCAGGCAGGAGTAACTCTGCTGCAACTCACGCTCGAGTCGCTGCAGC
AGCAATTGTTGCTGCAGCTGCTGTATCTGCAGTTGCTGCTGCTGCTGGGCTAGCAATTGC
TGCTGCACGAGCTGCTGGTGCTGTTGCTGCTGTTGTTGTTGCTGCTGTTGGCCACTAATT
GGCACCGCTCTAAAGTAAAACTGCGCGTAATCCAATGTGAAGGCGTTCCTCTACAGCTTC
GACGCGCGTCTACCGCATTCACGCTTGGCTATAGTTTGCGTCGCTCCCCGCTGTTGCAGT
TGTTGCTGCTGTCTTCCGTATCCTTTGTGTCCTTTTGTGGCTTTTGCTCCTGTTGCAGTT
GCAAGTGGCAAGACGTCTGAACCTGTAAGTAGAGCAAGGCATTGAGTTGAGTTGGCTGCA
TTTCAAATGCGAGTGCATAATGCACTCATTAGGCGGGCGTTAAGTATACGCCGTGTGTAC
ACAGAAAAACAGGGGCGTGTGCGTAAATTAGTTTCTGGTTTATAGTAAGTATAATCATTT
TATTATTATCTGTATAAACGAACGTTCAAGTAGAGTACTAAAACTTCATTAATTTATGCT
TATGATTGTATTCTCTGTAAAATAGATAACCAAGATATAAGCTAATAGATATGGAATGGT
TTAAATGGGCTTAGAACATTATGAGCCACCTTAATCCCGACTACGAACCCAGATTGAAAA
GGATACAAAATGAAAAGTAAGATTAACTGAGCACACAATTGATGGCTCCTGAAATCGTTT
CTTTGAAATGCCAATTTGCAGCCGTGCAAACTTTCTCAGTTTTCGAGGAATTAAAAGGAG
CACACAAAAACAGAAACGGTTGGATGGAATCCACGAAGGCAATTTCTTTGAAAGGATGTT
CTCTAAACATACGTTGAACATCTAAGAAGTGTAGAGGCATTCAAACGCATACTATGCTCC
CTCGAGTGTTGAACTCTGTTGAACTCAAAAATTAGAGCCCATAAAATGGAAATTTGAGGA
AGTGTGATGACTTGGTTAGCTTTTAGCAATATATTTGCAAATATAGAAAAAGACTAGAGG
AGCAAAAAATTAATATTACTTTTTACTAGTCCCTACATATTTACCTATTCTCACTAATTT
CTAATATTATAGTTGAATTAAATTTGTGAAAATATAATGTGCAGCCATTTTGGTCCTATT
ATCGCCAAATGCCGTGGGCTAAACCATTTCCACAGCATTATCCTTTCGCTGCAGAAATGT
CCTTAGCAAGTGTGGGTGGGGCAATAAAATCAAATCAAATTGCGCGTGCCTCAGCAAAAC
GCAAAACGGCGACCAGGAAGCGCCGTTGTGGCAATTTTGGTTGCGTTGCTTTTCCGCTGC
AGAATTGAGTTGCAGTTAGTTGAGATGTCTGCTTCGCGTGGGGAAAATGTCGGGGTAACT
GAAGGCAAAAATTGCTGGGTGTGTGTCTGTGTGCATTTGTGCTTTTTGACGTCATCAGCA
AATACTTTGCTACTGGCACAGGGACTGGCACTCGTTTTGTTGCTCTTGTTGTCGCTGTTT
GCACAGCTGCCATGGGGCCGCATTTAGTTGTTGCCACTACCGCTGCCTGTAGCTGGTTGT
TGCAACATTTACATTGGCAATTTGCTTGGAAAAGCACTTGCGCCACCATCCTCCATGTAC
CAGCCATTCGGAGCACACACACAACACAGACGCCAACGGACCCACTTCCGGCCACAAGTC
TGTGCTTTTGGCCTAAACCGAACTTCCGACATTTTCACCATGACCTGAACACCCTTTTGT
TTCGCTGGGCTTACTCCAGGGGAAATCAGGATGGGCTCCTTTTATAATATGCATTAATTA
AATTAAATACTTCATTTTTCGCTAATAGATTTGATGTTGTAATGTAATTAACCTTCGATA
AATTCTATAAATGCGCTGTGATTTATATATCTACATGATCATATTATATATACCAATGAC
ATATTTGTGATGAATCAATTCCAAGTTTATTTTAGCAAAAAATCCAGTCTGGTAATTGAT
AAAATTGTCAATGTGTAAAAGAGAATTCATGGTTTCCTAAGTAAAACACAAAGATCCGCT
GACACAGCTTGTGTTTTTTGTGTCTTTTTCTTTGGGTTTTAAATTCCACTTTTCCTGTGG
AAAAACCACGTTTAACTTGTGTGAAAACTTTTTGCTTCCAACACTTTAAGACTCCTCTGC
GTGATGGCAAAAACAATAATAAAAAGATCCAAAAGAGAGCGAGTAAAGTTTGATTCAACA
TTTAGTTAAAGTCGTTTGTATTGTTTTTCAGCGTTGGCTGTTTATTTATAGCCCACTTGG
CGGACAAAAGTGGAGAAAAAATGGAATTTGACAATAGTTTTTGCAGCGGCAATTAGGGGA
ACGCAGAACGGTGCAGGTCATAAAGCCGAGAATGAATTGCACAACAAAGTTGCAATTGAA
ATGGAAATTGAATTTTAATGGCCATTCGTACAGATCGCGCAGAATCCAACGTGGAGTCGT
ACTCCAGAGTGAGCGAATGGCTCAATAGACGAACAATTGTGTGCTTAAGCTGCATCATAA
ATTCACTGAAGTGCTCGCCGGGCAAACAAACAAAGCACACACGTTGTGGACAACGTGTCG
TATGCGCGATGGCAGATGAAGTGCACGCGTTGACGGCGCTCAAAGAACTATAACATTAAT
GCTAATTTAATTAGGAAAACGTGCCAATGCATGATTGTTTGCTATATACTACGAAATCTG
AAAAAAAATTTAATACACTTTAATTCAATGCATCAATGCCTCTACAATTAAATTCTTTTT
TGTCTAAGTTCGAATAGCGATTATTAATTTTCGCATTCCCTGAAAAGTTTTTCTCTAATC
TTTGACTGGAATCCCCATAAGATCAGAGCAAGTTCCTTTCAGTTCAAAGTCCAAATAAAC
AGCAATTCAGGCACATAACTTGCCAAGCACTTGAAGCCTTAGAAATTTGCAGTATTTTCC
CCAGAAGCCACTCACTTCCCTGTTCCACTGAAATAAGCAAAAGTAAAGTAAAAAAAAAGA
AGAAAATTTGTTCATTTTAATTAAATTGCATTCTCCTCGCAGTGCCACTTTCATCCGACG
AAGGATACTTTAAGCGAATCTCCCTCCAAAATACGCACACTTGGCTGACTTGGAATTTCT
GTTAATCAAACTCAGCGTTGAGCATGAAAATGCTTAATTGTATTATTACATAACTTTTAT
CCAACCAAATGGAGCGTCAAGTGTGGATGCGGACCAAGCATATTTCGCATTTTACTCGAG
ACACAAGTCGTTGGCAATTAATCCATGTGTTCGCCAAACATAAATCGATGCGGTCTCAAA
GGATAATTAATACGTCACCAGAACATAGAAATCTGAACATGACAGCAGCCAGTCGAATTT
CATATGCTTTATATGACATAACTTAAGTGCTCGCTCAATAGCATACATGATTACATCCAT
GGAAAATGCTCAACCACAATGAAATCAACGAATTGCCAAAATTTATAAATGACAACGCAC
ATTAAACACAAACAACTAGACGACCAAATGTAAATACGTAGATTTGTCATATTCCAGTTG
CAGTTAAAAATTGATAAGGTACCGAGAAACAGCTTTTGTTGCACAAATATTGCACTTATT
GTTAACCAAAACTCAGGTTATGATTTCCTGGAATTCATTAGGAAATTCATTGAGCCACTT
TGTGCTTTTTTGAGTGCATTTACGCATTTTCATGCGCATATGCATTTCCCAGTATGACTT
TTGTGTTGCAAGTCTTTCCAAGCTAATATACATTTTACTGCAAGGTGGCAAGCGAGGATG
ATCCATGAAGCCAGGATACGAGGCTCCCATAGAAGTGGCTACCTGAGGCGAGAGAGGTGC
AACGTGTGTGTCTGTGTAAACAGGAAGTGTTGCACCGCAGACAATGTTGCTGCAAAATAG
CCACTCAAATAGGCACCCTACTCCATGCCACGCCCCTTCGTCTACCATTTGGTATTTTGA
AAAAATATTTGCCTACATGGAATTATGAGGAGCCATCATTTAATGAATGGCCTGCCACCT
GTGCACGCTCTTAATGAGCTAAAATACGGACTGTGTTGCCAGTCGGATGTTAACTGCGGA
TGTTTGCCAACGTGTGCACATATGTACATACATATATGCATCTGAATATGAGGGTAAGAA
GCTTTTCAGCTACGTTCTGGTTGTGTAATTTTCTTTGATTATATGCACAATGCCGAATAC
CCTGTCCTTATGCCACACAAAATAAACTAGCAAATATGTTATGGTGTGGCTTAAGCTTTC
CGAACGAGTGTAGCTTCCAAATTAATTTCAAATAAATAGTGATACAAGACTGCATTTAAA
ATGCAATAAACTTTGGAAATTGGTGTTGGAATGCATGTGGAAAAGAGCACTATTTGCATT
TCGGCTGACACGATGAGGCAGCAATGAACATTTGTCCTGTTTGTGGCACATTCAAATAAA
TATTCGCTCACAAAGCACTTGATAGCAATTGTGTGCCCGACTTAAAGCCAACATTAAGTT
TGGTTTCTTTCACCGAAAAATTAATGGCCCGGCATTGGAATCTTGTTTATGGCATATATA
CACAAAATAGTTTGGCCAAAAAGCCGAAAAAAGTCAGAGCTGCCATAAATCAGAAGGAAA
AAGTGAGTGGAGCAAACGGTGGAGGGGGGCCAGAACGAATATTGCTGCGGCAGCAAAGGG
AAAGTTTGAAAAACGGCTTCGAGAGGGAAATGCTGAGGAAGTGGAGATTCCACGACACAT
TTGTGGCTGGCAGACGGGGAATGAAAATGGAAATATATTTCCGCCAACGACAATCAGGTG
AAATGCAAAAAGTGTCGAGGAAGTTGTCAAAACACTGAGATAACATTTTCTGGCCAGGAC
ATTGATGGCCAACGAGCTGTAGAAGATGTGCTATATCCTGGCCCTAATTAAGGACGGGGT
CTAACTTGTCTCTTTGCGATTTTCAAAGTACATTCATTTGTGGAGGAACTTTTCCATCCT
GGCGGCTTTTGTAGGCTCCGTTTTTATTTATCGTGCCACAGCATCATCGAGGGCAATATA
TTTTCACTGCGCTTGCATTTTACATAATTTTTACCCCAAA
Chart Advanced