SelenoDB
Release 2.0
Chart Advanced
Sequence Report for SEQ00000614_2.0
Identity
SequenceGlutathione peroxidase 5 (GPx5)
SpeciesDipodomys ordii (Kangaroo rat)
DescriptionGenome -assembly-
Sequence IDSEQ00000614
Sequence release2.0
External IDNone
Gene SPG00000615_2.0
Annotation
Prediction method(s) None
OrientationForward
Toolbox
Sequence
>SEQ00000614_2.0 # Sequence # Glutathione peroxidase 5 (GPx5) # Kangaroo rat 
ATTTTCACCCAAGCTAGAGGGACAGTGGCACAGTGTCCCTAGGGGCACATCAGAATGCAT
CTGATTGGTGTAAACATAGTCCTTCATTTGCATAAAGGTCTACTGTGATTTGTGTAATCA
CTCTTATCGTACACATACCTGTTTGCAAATACTACACACAGCTTTATGACTATATAAGCT
GTTCTTTTCAAGTCAGCCAGGAATCATCCTGTTTTATTACTTGCTGGTGTTGCAACAATA
GGTGTAATATGGGTCTTGTCTCAAATGGTCTTTTGTTCTTCTTGTTTTGTGATAGAGATT
GAAGCCAGGGTCTTGAGCATGCTAAACAAGTGCTCTACCTCTAGACCATATCCAATTCTA
CCCTTAAGCAAACACATCCTCTTCCTTTAAGAGAGTGTCTTGCTGGCTTTGTTCTGACTG
AATTTCCAATCCTGCCTGAACTTCCCCAGTAGCTGGAATTATACACATGTGCTGCTATCC
ATGGCCCAAATACTCTATTCTGCTCTACTTTTTATCTTTATCATTAGTAGAGTGAGCTGG
TAACAGAGTCAAGAAGGTAGAAGCTGCAACAGAGCAGAAAAAGGGGGCAAGAGCCAACAG
TAGCTGTATTGGCAAGAGGCAGCTGAAGAGTTTCAGAGAATAGGATAGAAATGACAAGGC
ATAAGTAACAGATTCAATGAAAGATGGCAGGAGTAGAGAGCAAAGTGTGAGCAGATAGAG
TTGAAGAAAAGTCTATGAGAAGCCAGAGGAGAAAAACTTCAGACCCTGGCTTTGAAAGAG
TTCCAGAAAGCTGCCAACTTTTAATGTCTTAGACATCAGTAGGCCCAATAGTTAAAACAC
TAGCCAGGTGGGGAGTGAAGCATTAGTTTCTGCACCTAAGAGCTATTACAGCAGTAAAAC
TGAGCACATAGAGCTCAGGTCCATAGACCCTCAGCTCTCAGGGCTAGTAACTGTGAGCCT
CTGTGTCTGCCAGTCCAACCCTTAAACCTCAAGTATGCAAGGGCCCAGAACTTTCAGTAT
TAGATGAGTTTCTTGCCTACTCACGTTTTTTATCTGGGTAAAGCAAAAGGACCCCTGGAA
CGATTGTAGATTCAGTTTCTTCCCCCCCCCCCTCCATACACACACACACAGCCTTCTCTT
CTCTTTAGTGTGGGTTACTTGAATTCCTGTAGCTGGACATGAACATAGTGTATTCTCTCC
CACACCCTCCTCCAGCCCATTAAGGCAGCTGTAACAGACAAGAACACTGCCTAGAGAAGT
ACACATTATTCCTCTCACTGCCTCCCCATTCCAACTTCCAAGAAGCAGCTGTTTTTATGG
ACAAACCCAGACGTCTGCATGTCAGGGCCAGCTGCTTAAGTGAAAGCTCAGGTTCAGGGC
CCAGCCAGCACTGACTAATGTTAAACCCCAAGTTTTATTCTTTCTGGAGAAGGAGGTCAT
AAATTGATAAGCAAAGCACCACTTACTTTTATGCATTTTCAAACATATAATGGGAAATTG
AGCCCAAAAGGCAGTAAGTCAAGAGGGTTTGAGTAAAAACTCCACTTTAGTGTAGTGTTG
GTCTACACTATAATGCCTTTGACCTTGCTTTGCCTTGACTTTGCTCTTCTGAACTCACTT
TTCATTTCAAATTTGAACACATGAGCCAGGCACAGGTGGCTCTTGCCTGTAATCCTAACT
ACTCAAGAGGCTGAGATCTGAGGACTGCAATTCCAACCCAGCTGGGTCTGAAAAGCCTCT
GAGATTCTTAATTCCAATTAGCAACCAAAAAGCTGGAAGTGGATCTGGGGTTCAAGTGGT
TAAAAAAAAAGTTAAGGGACAGCATATAGACTTTGAGTTCAAGCCCTAGTACTGGCAGTC
AATCAATCAGTTATATCTTGAGGACTGGAAAGAATTCATCGGGTCTGGAAATGGACCCTG
GAAAGGAGGCTGAGAACTTAGCTTAAGAGCTTTCAATACCATGCTGGAGAGTGTAGGTTT
AAAGACATAATAAATTAGTTCGCTTTACTGACTATATGCCAGTAGAGGGTTATCTCCCAT
AAGTATTGACTGTCAAGGTATTGAGGAAGAAGGATTAAAGGGGAAAAGCCATTAGGAGAC
TAAGTAGAGGCTAAGATTCTTTAAGAGGATAAGTAGGAGATAATTTCAGCTTCCAGAAAA
GAAATGGTAAAAATCTGATATGTGGTTCGGGTGAGGTGTGAAATGAAGTTAGCAAATAGC
TATGAGAGACTGTCTGGAAGATGATAGGAAATGTGGCCTTCTGTTGCACCCAAACTCCTA
AGAACCAGAAAAGAATTCGTGTCTTGTCTCCTTTGTTTTTTAAATTAGCTCTGAAAAGTT
TGTATTATTCCAGCCCAGTTATTTAGATGAGATTCAGAGACACAGAGAACAATTTGCCCA
AAGTCACAATGCTTAGGAATGCTTAAGGAATAGAAGAACATTGTTCAGAGACTTAATATT
TTCATCTGTATAACTATGAGCTGAGATAGATGGGGAGGGCAGGTGAAACAGCATCTTTGG
GCAGGAAGATGCTTTAGAGCAGGAAAACTGCAAAGCTTCCTTAAAGGAGATTTGTGGCTG
GGTAAGCCTATCATTTAAGCTCCAGAGCCCAGATTAGAGGCTTCTGAGAAGAGATCAGAG
ATCTGGGATGATAAAAGTTTCTATTTTCTAAGAGAGCCCATGAATGTCCAATTTCCCAGT
ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNTATTAAAAATGAATTCTATTTCATAATCCTTTATAACCTAATAATAACA
AAATGTCAGAAACTTGAAAGTTATACACAACCCTTTGAAACTAAGGTCCCTTTGGAGCTA
AAAATCTGATAAGGAATATAAAAGTTTTCAAACATGCATGCAGTATTAAACATATTACAT
AGGCCTGTGGTAAGGGAAAGGAAAGTGGAGTTTGGAAATCAAATAACATAGATAATTAAC
GAGATTAAAGTGAGATTTTTCCAATTACAAATGATCATGAATTTAGGATTACAGTTAATT
AAACATGAGCACTTGAGGAAAGAAAAAAGAAAAAGAAAAAACAGCTCTAGTGTAGAAGAA
AATCATGGTCAGACTTCCATTGGATTGACGGGTAGGGAGTAACTATGCTAATTTATGTCA
GAAATCTAGAAGTCCCTATGGTTGAAGGACTACATTTATCAACTCACTTGTTCCAAAAGA
CGAGGAACAAGTGTTGTAAATGACTACTAAATGGATGGGTGTTTATGTCCTGGTTAAAAG
GTAAAACATCTTTATTCTGAGATGACTTTGCCTTTCATTTCCATAATTTATCTTGGGCCC
TTTGGTTTCTAGGGTTAAGGGGAGTGTTTGCAACTTCCTGAAAAAAGTATAATTATTTCA
AAATACAAAATTTTAAAAGTTATTTACCTTTTTTAAAGTACTGTATTCAGAATAAGAGAG
TGTCCTCAAAAAAAAAATGGCAGTATTTTCCAGCCTCTACCTCATGTATACAAGTTTAGT
GTGTAAGAAGACTGCACCCAGGCTGGACACCACCTTTCCTTTTAACTTTTGCCAATCTGA
TAAACATAGGATACATCTTTTCTTATTCGTACTTCTTTGATTATTGGTGAGAGAACATTG
TATCCTACCACAGAAGCCACTTGATTTCCTGTCTGGTTCTCATTTTTCTGATTTTCACTG
ATTTATAAGCCCTTGAAAGCAATTACATAATAAATATATTAATGTGCTGATATATACTGT
GCCTACCCACCCCCTTTCTTCCCACCTCTCCCAAATAGATCCTAGGTGGTCTCTCTTTGA
TTAAAAAAATTAAAATAAAATATTAGCTGGGCACTAGTGGCTAATCCTAGCTACTCAGGA
GTCTGAGATCTGAAAATCATGGTTTAAAGTCAGCCCAGGTCCCCATGAGATTCTTATCTC
CAATTAGCCACCCCAAAACCAGAAGTTGTGTTGTGTCGTAAAGTGATAGAGCACTTGCCT
TGAGCAAAAGAGCTCAGGGACACACCAAGGTCCTGAGTTCAACCTCCACAACCGACAAAA
TAATAAAATAAAGCAAAATATATATTGGGTATAATACTTAATACTTGTATTTTCTGTTGT
TTTTTGGTTCGTTTTGCTTTGCGCATCACACTTGGGATCTTAAGCATGCTAAGCAAACAC
TCTGCTACTCAGCTACATCCTTAACCTTAGAAATGGTATTTAGAATGTCTATGTGGTGTC
TTTTGCAGAGAAGTCTGGGAGAAGGCATCTACATCTAGACAGTTCCATCCACTCAGGAAA
GATACACAATAGTCCTGAAAGACCTAAGAAAGCTAATATAAATTCTGCCAGATTCTCATG
GCACCGGTGAGCACTGAGTGTACCTGGGGGTGTGAGTAGGTGAAAAGATGACTTGAGTTT
TCTGGTTGTCACACATCAGGAATCTTTGCTGCCCTGTCATTGGCCTATAGGGGCTTTCAT
TAGTCTCTGCCAAGGCATCAAAAGTCGGTGGAGGTACACAAAGAACTCAGGGCTCAGACT
AGGGATCTACAACACTAGTCATGACGGCAAAGTTAAGAGCCTCCTATCTTTTCCTCCTTC
TTCTACCTGGCTTCTCTGGCTTGACAAATTCCAAGCCAGAGAAGATGAAGGTGAGTAAGC
TGCAGAGAGGGGGGCTGCAGGTTACAGTGTGGTTACCCTTCTGTCCTGCTTCATCTAGAT
CTCAACCTGCAGTCCTTCTTGCAAGATTCTTAGCTGTTTTCTTCCTCCTTTGGGTTTCAT
AAACCTCTCCTCTCTTTTAATCTTCTTCATGCCTATAAATGGTTGTTCCTTGAATATAGG
TAGAGAAGAAAGGATGTTTTTTGCAGTGAGATCCTTTCTCTGCTCCTTCTCCAAATGGAG
GCCACCTAGATACCTACTCCCCTGCTATGCCAGCTGGGTCTGAGGGACTGGGGTTTGGAG
GAGAAGATGAGCCAAGTCATCTCAGACACAAATGATCATGCATGAAGGTTTCTTGATGGA
AAGAAAAAAGTGAATGTAGAAGTTGTAGAGTTAGGGGCTGGGAAGGTGGCTCAGTGGTAG
AACACTTGCCTTGCATGCCTGAGGCCCTGGGTTCGATTCCCAGCACCACATAAGCAAAAA
GAAAAAAGCCGGAAGTGGCGCTGTGGCTCAAGTGGTAGAGCACTAGCCTTGAGCCGAAGA
GCTGAGGGACAGCGCCCAGGTCCAGAGTTCAGGCCCCACGACCGGACCCCAAAAAAAAAA
AAAAAAAAAGAAGTTGTAGAGTTAAAGTCATAGAGACATCAGAGATCCCTAAAAGCCATG
GGGACAAATAATCAGAGGACTAAAACAACTGGAATTGGAGTCAGATGTCTCGTGGTATGG
TGTCAGTTCTATTCCCACACTTTTAATTGTTTTATTGATAAAATGTGTGGCTGTGACAGT
AGAAGGCAGTTCAAGGTAGGATCATAATGAATACGATGACTTAGAGGCAAAAAGGAATCG
AGAAGTTAGAAGCAATTCACATAGTGAATTCTCTCTTTGTGTTCTGGTAGAAAGTTACCC
ATCACTAACTTATAGGTAACAATACTTTCTTCTTATGCCACAATTATTATGCATATAACA
TGTTCTACAAAAAGGCAGCTTTGGGAATATTTTCACCTTGCTCTGAAATTAACTAGAAAT
TTGTACCAATGTCGAGCTGTTGTTACTAATGATATAATAATGTTAAAACATCTTCCAGAT
GGATTGCTACAAAGATGTGAAAGGCACCATTTATGACTACGAGGCCTTCAGTATTAATGG
GAATGAACGTATTCAGTTCAAGCAGTATGCTGGCAAGCATGTCCTCTTTGTCAACGTGGC
TACTTTTTGTGCTCTAACAGCTCAATATCCTGGTAAGAAGTCAGAGCTCTATGTCTTTGT
GATTTATATTCTAACTCACACTTGGTTTTATGTTCTAATTGTAATCACATGCCAAAATTA
ATACTAATAATTGGGGTGACTTCACCCTTTGATGTCAGAAGTCAGCCAAAGATCAGGTAT
TGGTGGCAGATGTCTGTAATCCTAGCTGCTCAGGAAGCTGGGATCTGAGGATTGAGATTA
GAAGTCTGCCTGGGAAGATAAACCTAAGAGATTATCTTTTTTTTCTTTTTTTTTGTTGGT
TGTGGGGCTTGAACTCTGGGCCTGGGTACTGTCCCTGTGCTCTTCAGCTCAAGGCGAGCG
CTCTACCTCTTGAGCCACAGTGCCATTTCCAGTTTCCTAGTGGTTTATTGGAGATCAGAG
TCTCACAGTCTTTTCTGCCCAGGCAGGCTTTAAACAGCGATCCTCAGATCTCAGCCTCTT
GAGTAGCTAGGATTACAAGCATGAGCCACCAGTGCCCAGCTTGAGATTATCTTTAATTAA
CCAGCAAAAAGCCAAACATAAAGGTGTTGCTTAAGTGGTAGAACTGTAGCCTTGGCCAAA
AAACAAAAATATGCTAAGTGGAAATGCAAGGACCTGAGTTCAAGCCCCAGTACTGACACA
CAAAAAAGATTTTAAAAAAACAACAACACTTATTTGAGGTTTTTAATGCTAGTGTGTTTT
GCAGAAATGAAAAAAAAAATCTTTTGCTCTCTTCCCTTCTCTCCAACCAATGATATTTAT
AAAATATTGCTTTTCTGCTCTCTCCCTGTTGATAACATACAACAACTACTTCTTCTTGTC
TTGATTTTTGTTTAACTGACTAAGATACTCTATGCTTTTCCTTTTGGTTCTTATTTGTTT
TTAGTTTTTGAGACAGGATCTTACTCTGTAGCTCAAACTGGCTAGGAGCACATGCTCCTC
TTGCCTCAGTTTCTCTAGTATTGGGATTACAGGTATGTACTATTACATCCAGTAATAAAA
CACTTTTGAGTTCAGTCCATTCTCTCATTCTTTTAAAGTCTACTAATATTTACTGGACTC
TTATTCATTTTCTCTCATTTATAGTACTTTAAAAATCAATTTATTTCATTTTCTGCTTAG
CAAATAACAGATGAGGAAACTGAGGAATAGTAGTTGCTCAAGATTTCTCTTTTCTAGAGG
GAGGATTGTCTGCAGTTCTGAAGACAAGCAGAAAGATATGAGAGGTTCTGAGGAATCATG
TGAAACAGAAAACAAGAAAGCAATCACTATTTTTAAAATACGGATAGNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACAGTGAAACGTGCCACCGTTAGCAAGAGC
AAAAAATGTTAACAAAAGTGATTACAGACATCTGAAGAGACAGGATAGAACACTTCTAGA
GAGTGGTAAAGGCAATTGGAGATTGAGTTTTGGCACAGCACCAAGGATTTTTAGGTAGAA
TGCATCCTGACTATCCTGAAGATGTTTAAACAGCATCAGGAAGCTCCGCTTGAAATTTCT
CTGTTTTGCCTCTGCTCTCTGCTCAGAGCAAGTCAGTCTCCTTGACATTGTCTTTTCCCT
TTAGGAAAGGAAGACTCAACCTATCAATTAACCAATCAGAAAAGGAAAACTGATGAGCAG
TGATGTTCCAACCCCGCTTTGTCTAAAACTCACTAGGGTTTTGAGTAATAAAAATGTTCT
GGGCCCCCTCGCAGAGGAATGGGGACAGAAACCTCTCTAAAATGGGGACTTGGGCATTCC
TGTTTTTAATGATGAGTCTTTAGGTGATTACAGTATACTGCACCAGAGTATAGGGCTGTA
GAGAGTCTGTCTGTAGACCTAGTATCTAACAGCCATGCTACTCACAGCCTGATCTAGAAA
TGTCTCCCCCTCCCCTTCCTTCTCTGTAAAATGAGTCACCCCAGGGATCTTTGTCTACAC
TGAGGGTCATAGGCCAGGCCGCCATGCTATCCCTTTTCTAACTGCAGAACTGAATGCACT
CCAGGAGGAGCTGAAGCCCTTGGGCCTGGTCGTATTGGGCTTTCCCTGTAATCAGTTTGG
AAAGCAAGAACCAGGAGAAAACAAGGAGATTCTTCCTGGGCTCAGGTAAGTGCCTGCTTG
GAACCCAGTAGGAAGCTACTTGTCGCCTTGTCCTGTTTCCACAGGGCCTTCCATCTTGGG
AACCTTCTGGCTAGGGAGTAGATTTAACAGGCTCAAGGTTATCTGCAAGTTGATTTTAAC
TATGGCCTGTGTGCTGCTGATGTCTCTGATTATGTCCAGAGATTCTCTCTCCGTCTTTGG
CTGACACCTGAGTGGACGGTAGAAATCCAGAGAACAGAGGTACTTGGCACAGAGAAAAAC
AAAGTGAATCAAGAAGCCCAGAGTCCCCGCCTACCCTTATTCTCCTCCCTCCTCCCATCT
CTTGTCTCAGCCCCTCTCTGACCTTTCAGCCACTTTCAAATCCCCGGGTCCCATTACAAT
CACTTGCCTCCTGGGAACATTTGGCTTGTTGCAGGTATATCCGGCCCGGGGGAGGATATG
TACCTAATTTCCAGCTTTTTGAAAAAGGGGATGTGAATGGTGAAAAAGAACAGAAAGTCT
TCACGTTCTTGAAGGTGAGTGAATTACCGCCCCTCCTTTTCCCTATGTTCTTGTCTGTTT
TTGGAGATAGTCATGCATTGAAACCCAAACTGGCTTTGAACTCACTCTGTGGCTCTGGCT
GACCTTTCCATCCTTCCACTTCAGCCTCCCAAGTGCTGGGATTACAGGCATATACTATCA
TACACAGCTCTCTCCTAATAGTCTTAGCACAGAATTGGTATGATGTGGCTAGGATTACAG
GAATATGCCACCACATACAACTTTTCTCTAACATTCTTAGCAGCTGATGTGGTGGACTGG
ACCCTAGGGATGCTGCCTGGAGTTGGAATTATTAATATGGATAAAATCTCCAGATCAGCA
TGATGACTCGCATTTAATGTTAGCCTTCATGGTATAGTGTGGAGTAGCAATCTCTTGCCC
TTTAACACTCATTCATTCATTTAAGGAATATTTAACATGTTTGCTATGTATAAGGCAAAC
TAAATAAAAAGAACATTAACATGAAAAATACAACATCGTGTAGTGGGTACCTCATTTAAC
ATTGACTTTTAGACACAGACTTTGCCAGCACTGAAAAGGCCCCAAAGATAACTAGCGTGA
AGTATACCTAAATACTGGACGATGAACCAATACCAGTGCACTGGTAACATTTTCCTATAT
CCTTAGTAGGTTGAAGAAAATAGAACAGTGTGAAATGAGGGCTCACAAAGGACTGGGAGC
ATGGCTCGAATGATTGAGCACTTCCCAGGCTTGACCCAGAGTTCAAATCCCAGTACCTTT
GGAAAAAGAAGGAAGGTACCATAAACTAAAGACTTCTAACTTATAAGGCTTCCCTTACCA
GATTACAATGTTATCATGTGTAAGTGTATGTGTGTGTGTGTGTGTGCACGCATGGGTCTG
TTGCTTTGTGCTTGCTAGACAAGTTCTCTTCCACTTGAACTACACCCACTGCTCATATTG
CTCTTTCTAACATTAAGTGATGTTGTCTTAAATTTTTTTCTTATTTGATAAAATGTTAAT
AATTATTAGTCATTACCCAAAAAGAAATTGATCAAAATGCTACTGACCTGGGAAAGCACA
TTCTTGATGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATATGAT
GGGACCCTGGAGTCAAAATCAGAAAGAGCAGATTTCAGTTCTAATATCTGCAAATTCTTG
ATAGATGCCATGGTGGTAATTAGGAGAATTTACGGCATTTACTAGGAATCACAGGAAATT
AACATGTCCAGCATAGAATGGATAAAACTACGTTGGTCATGAGAGAAGAGGAATGATGTT
ATTGTCTCTTTTCTGTCTCTCTCTTCAGCACTCCTGTCCTCACCCCTCTGAGACTCTAGG
CTCATTGAGACATATATCCTGGGAGCCTGTAAAAGTCCATGACATCCGCTGGAACTTTGA
AAAGTTTCTGGTGGGACCTGATGGAGTCCCTGTCATGCGCTGGTTCCACCGGACTGCAAT
CAACACAGTCAGGTTAGACATTCTGATGTACCTGAAGCAACTCAAAACTAAACAGGAAGG
ATGAGTTTTGAGCAGAAGCCATCTTGCTTCCCATCTACAGACCTGTGCTGGAAAACTTCA
TCTTCTCATCCAACATTTTTCTAAACAGACTCTACTTGACTAAGTCACCTCTATAACTGC
TGAAGTTTCTACCCTTTACCAAGTAGATAGATTTCTATTTAGACAGCTATTGATATTCCT
CTTTGAAAGCATATGTGGATGAAAAATAAAATAATAGAATCCCTCTGTTAAAAGATTGAA
TCATGCCAGGTGCCAGTGGCTCATGCCTAGCTAGCTATTCAGGAGGCTGAGATCTGAGAA
TCGAGCTTCAAAGCCAGCCCAGGCAGGAAAAGTCCATGAGACTCTGATCTCCAATAAACC
ACAAGAGAATCGGAAGTGGTGCTGTGGCTCAAGCAGTAGAGCGCTTTCCTCAAGCTGAAG
AGCCCAAGGACAGCGCCCAAGCCAGAGTTCAAGCCCCACGACCGACCAAAAAAAAAAAAA
GGATTGAATCATTCATAGCTACTAAAAGAAGACTATCCTTCCAGGAGAATGGCTCATATC
TCCAAGAACTCTTTAGCCATTCTGAGTCCTCCTCTCTCTACCTGGAGGATGTAGAAATAC
TGATGAAGTTATATGATATAGCTTGTGATTCCTAACATTTTTGTTTCCTAGAAAAATTAT
GTATTGTCCCTTCCGAAGGCTTCATCCAGGATACTCAATACTTGTCATTCTCCTGTGGGG
ATAAGGGAGAAGCAGAGAACGCTGATTCACCTAAAAGGAAGGCATTCCCATGTTGTTGAA
AATGGGACTTCCTTCTGTTTAGCCTTATAAAAATACTTTGTGTTAACTTACTACCTGATC
TTTTAGCATCTTCAGGTTATGACTTCTGGATATTCTTTTATCTTTGGAAAGATGAGATTT
TTTTTTCCCTTTAATCCAAAATGTTTTAGCTTTAGAATCAACTTGTTACTTCTCCAATAA
ATTGTTTTCTGCAGGATCTAAGATCTCTGTGGTGGTGTCTGTTTAATCTTATATTACACT
TGGACTCATCTTCTATTTATTTATTTGCTTTTTACTCTTTCTTTTTCTTTTGTACTAGTA
CTAGGGACCTATGTTCTGTTCCTTGGCTTTTTCAACCAAGACTAAAGCTGTACCACAGCA
CCACTTCTGGCTGGCTTTGGTGGTAAATTGGAGATCAGAGTGTCAGGCTTTCCTGTCAAG
GCTAGCTTTGAGCTTTGTTCCTCAGATCCCAGCCTCCTGAGTAGCCAGGCACCCAGCTTT
GAACCCAACTCCTCCTCTTGCTTAGTTTACCAGTGATGTTATAATACCCTGATTACACAA
ACTAACCCAGACAGAATGATTTGCCATTCCAGATATTTGGAAAGTTGTCACCTAATGATT
ATCAGCTGTCTTCAGGAATTGCCTCAGGCCAATTTTGTCTCTTGAGATACCTGATGCCTT
TTGTGCTTATATTCCATCCCAGTTTTCCCCTTGGATAGACTCTGCTTCCCTTTCTAGCCG
TGTATTCTATTCTCTGACCAGGATAACAACCAAATTCAAAATGGAACCTACTAACAGCCC
CAGGTGTTAACCCAGAAGTAAATCGGCATAGTAAGCTTGCTAAATAAATGCTCCACCACA
GAGCTAAATCCTCAATAACTCTCTTAGATTCTGTTTTGTATTTGTTTTTACTAGTCCTGG
GGCTTGAACTCTGGGCCTGGGCACTGTCCCTGTGAGCTCTCTACCGCTTGAGTCACAGCT
CCACTTCTGGTTTTCTAGTGGTTTTTATTGGAGATAAGAGTCTCACAGACTTTCCTGTCT
GGGCTGGCTTTGAACTGTGATCCTCAGATCTCAGCCTCCTGAGTAGCTAGGATTACAGGC
ATGAGCCACCAGCGCCTGGCTCCTGAGCTTCTTGTATTCAAGGCTAGCCCTCTACCACTT
GACCCACTGTGCCACTTCTGCATTTTCTGTGGTATTGAGGAATAAAACCCAGGGTTTCAT
GCAAGCTAGGAAGGTACTCTAGCCTTGAGTGATGAATATCTAATTATGGTGACTCCGGAG
GCATAATGCCAAAGGGCACTGCAGGCAATGCCAAGGTTTTACTGCCCTCTAGCCTCTACA
AAGGGAGAGAACATATTAAAGTTAAAGGTCTCTTTAAGGACATATATTGTGACAAACTAT
ACCCAGACCTCTTCAAGACTCTGAGCCCTTTTGATGACTGGTTGCCAACACTTGGCACAA
ATATTTGACAATTTTTTTCCTAAAAAGAAAGTCATTCACTGTACTAAATTTTATATATAA
AAAAAAAACAACAACAAACCATCATAATCTCAGGCTCAGCCTTCAGGTACATAGAGAAAT
GACTGGTTTCTTGACTAAATAAAGGTGATGGTGGTTTTTAGAAGTTATTTTGGTAGATAA
TTTCCGTCCTGTTTTCCTTTCTTCAGTCTTTTTCCCATTCCTACAGCTTCCTCTGGGATT
TTTATCACCATTGTAAGATCATGATGCCTGTAGACATGACTAAGATTCAAGAAATGAGAA
AAGGATTTGACCGGTTACAGCCTTAGAGTAGGGACTTTGTGTATGCCATTAAACTTTTTT
TAATGTATTGTTACTGTAAAGGTGATATACCTGACATACATAACTGTAAAGAGTACATTC
TTTTCAGATAGTGTCACCATCTTCTCCTCTCTCACTCTCCCAGCTTTTTCTTCCTGTCCC
CACCCACATGTTATACATAGTGTCTAGTGAGCACCACTGCTAATTTACTTACCAAGAGGT
ACCATGGACTTATCAATAAGGACTATTTACAGTATTGTTGATAACCAGTCATCAGATGTC
TCATGGCCATGAGACAAAGCATGTTGCTTTGTAATGTGATTTTACGCTAGCTTTCCTCAC
AAGGTGAAGCCTATTTCTCTCCTTGTATGTTGAGTTGTCTTGTGATTTTCTTTGACCAAC
ACAATGCTGTGCAAATCGTGTATAGAAGTGATGTGGGAGTTTCAAGGTTGGGCCACAGAA
GCCTTTCGATTTCCTTCTTTCCTCCCCTAAACTTATCCTGTGAAGAAACCCCATTTAGCC
TCTTAGAGGGTACACATGCAAAGAGAAAAGGTTCCAGCCATTTCAGCCATCCCTGCCAAT
TTATAGGTAGCAACCTCCACACGGTGAGTTGAGATTATATTAGATCATCCAATCTAAGTT
ACAGAAAGTCCCCAACTAGGACCATGAATGCTGCCAGACAAATGCATTCACATGAGCAAC
TGAGACAAAACCCCCAACAGCACTGATCCGCTAACTGTACCCCAAATTGTTGACCTGCAG
TGTTGCCAACAAGAAATAAAATTATGGGCTGGAAGGTGGCTCAGTGGTAGAGTGCTTGCC
TTGCATACATGAGGCCCTGGGTTCGATTCCTCAGCACCACATAAGCAGAAAAAGCTGGAA
GTGGCACTGTGGCTCAAGTGGTAGAGTGCTAGTCTGAAGAGCTGAGGGATAGCACTCAGG
CTCAGAGTTCAGACCCCACGACCAACAAAAAATAAAAAAGAAATAAAATTACTTAAAGCC
ACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAGGGCTTTTAGATATAAAAC
TGGATAAAAGTTTTAAAGTCCTTTATTGGGCTGGGAAGGTGGCTCAGTGGTAAAGCGCTT
GCTTGCATGCATGAGGCCCTGGGTTTGATTCCTCAGTGCCACATAAGCAGAAAAAAAAAA
AAAAAGCTGGAAGTCGTCTCTCAAGTGGTAGAGTGCTAGCCTTGAAGTGAAGAGCTGAGG
GACAGCGCCCAGGCCCAGAGTTCAGGCCCACCACTGGACCAAAAAAAAAAAAAAAGTCCT
TTATTTTCTCAGGTGTCACATGGTTTGTCTCTGTATTCATTTTAGGCTGATAAATCCTTT
ATATTGTAATAGATCTAGCATAACCGATAACTTACCTTTGTAGAATTGTATCACTTGCAA
ATAATGCCACTTTTATTTCTTTTCCAACCACCTTCTCTTTCTTTTCTTCTCAATTTGCCT
GCAAAAGGCAATGAATGAGGTACACAGGGCAGTCTTGACTAGAAGTTGTGAGAGCTGGTA
CTGCTAATTTGTGACCAATCTCAAACTGAATGTTTCAATCCTGCATAAGCATATTTTAAG
ATTAATCCTAATCTTAAAAATTACCTTATTATATGTATATTATTTACCATGTTAAAGAAA
TTGTTTTCTTTTACTAGGATGCTCAGAGATTAGGATGAAAAATTATTGAATGCTGTTTTT
TTTTCAATTAAG
Chart Advanced