SelenoDB
Release 2.0
Chart Advanced
Sequence Report for SEQ00000554_2.0
Identity
SequenceSelenoprotein W (SELENOW)
SpeciesDanio rerio (Zebrafish)
DescriptionGenome -assembly-
Sequence IDSEQ00000554
Sequence release2.0
External IDNone
Gene SPG00000555_2.0
Annotation
Prediction method(s) None
OrientationForward
Toolbox
Sequence
>SEQ00000554_2.0 # Sequence # Selenoprotein W (SELENOW) # Zebrafish 
GGGAAACTGGAGCACCCGGAGGAAACCCACAGGGAGAACATGCAAACTCCACACAGAAAC
GGCATCTGACCCAGCCAAGGCTCAAACCAGCGACGTTCTTTCTGTGAGGCGAACATGCTA
CCCACTGCGCCACCCCGTCGACTGATTCCTGTATATTTATTTCATAAAGTTTCTAAAGTT
TGTCCACAACCTCTTAAAACACACTTGGGACACGTATATATCTTAATTTCTGCAGTAAAT
ATACAGATGTAAGTGCAATACTTTTGTATATTTCATCATTTCAGCGAGGGTAATGATAGA
CTATAAATGTATGTGTAAATGACACTTGTGTACCTAATCATGACAGGGTATACATTTAAC
TACATGTACATAAGATTGTAAATACACGCAACACTATTAGAATACAGACATGTACAAATG
TATGCAAGCGTATATTAATGCATTTTAGGACATGTTGTGCATTTGTGCCATCTAGCCACG
ACTAATTTTGGCCGGGGAGAAGACTTTGCATTCGGACCAACAGTATACAGCTTTTGTGCC
GTCCTGCCATGACCCCTTTTGGCCAGGGAGAAGACGTTGCATCCGACTAATGTTTGTTGG
GTAAATGCGAGAGCTCACTCACCTCCAAGAAGGGTCCAGAAACATTCAAAGTCTAGAAAT
GGAACCAAAAACATTGTCAAAACATTTCATGTGACTTCAGTGGTTCAACCATAATCATAC
AAAGCACCAAGAACACTTTTGTGTGCCAAAAAACTACAAATGCATCTTTGTTTTCTCTTT
CATGACAGGTCTGAGTGCAGCCGTATGACCTATTGCCATTTATGCTGGTTTCACATTAAG
TGAAGTATTTGCTTGTTACTTACAAAAGCCAATGCAAATGTACAAATAGAGACAAATTTC
TACTGGGCAGCACCAATGATGTGGGATGCATGATGCGTTTGGTGCATACGTACAGAATTC
ATCATGTATTTCTCCCAATCAGCAACATCCCGCTCTCCCTCATGAAGCCAATACGGAAAT
AACTACAACTGCAATTCATCGGCTGGCCTTTGGGGGCTGGCTCCAGAAACCCCAGATATC
CACTGACTGCTATGCTAAATTGGCTATTTTTACAGCTGATAAAAACGTGTTTACAGCCTC
GTACAATAGACAGTTTTGGTCTATAGAGCTAACATTACTCTTCATGACAACTGTGAGGAG
GGTGAATTTTTTTTTATAACTCATTCGTTTAATTTATACTCTATAAAGAGCTCAGCATAT
ACATCATATTTTTGTTTTGTTTTATGTGGCTTAACCCAGTCAGTTGCCTTTTGGGATTAT
TTCCTGCAATTATGAGATAATATGGCATGCAGTGTGCACTTAATTGTGCTCACAAACCAT
TCAAGTGACCTCTTTTTCCCAGGTGAGCGAAATTCTTCTTTTTGAAAATTATTGAACAGT
CATCTGAATTGTTGTCATACAGTGTTATGCCTGGATTTCATAAATAGCCTTACATTTACT
AACACAGACTATATTTGAAGTATTTGGAAGTAATTTGCATTTCCCTCCTGTAGAAACGCA
TCAAAAGAACAATGTTTAGTGGCTTAACAGTGGTTTTAAAACAAATCGTAGGTAAACAAA
TCGCAGGTAATGAAGTATTAAGCGTTTCTCCCAAAGAAAAACTCATCTAAGCAAAATGCT
AACAGGCATTTGTAGCACCTTCTCTTTGCCTGTTTTCGGTTACTTCCAGTTGGCGCGATG
ACGCACAAAATAACGACGGTTGGCCACGCCCACTTGTAGCTTCATTTGTTCTCTTAAGAA
ACCTATTGGTGATGTCACAAATACTACGTCCATATCTTTTACAGTCTGTGCTTCCCAAGT
AAAAAGCAATTGCAGAAAAATCATGTGAGGCAAAAAAACATCCCATGAGTAAACCAGAGA
GAGTGATACAAAATGCATGTTTTCTTGCTTTTAATGTGATTCCATTATTCGAGTCAACTG
CTCGACACACAAGCATAGCATTGCCCATAGTAAACACACACCCAGGGCTTAATTTGTGCC
AAAACACGCCAGATCCGGAACCTCTGAAATATGTTCCAGCACCTCATTTTACCGATCCCC
CTCCTCAACCGCCCTGCTCCCCTGTCCGCTGTTTACTTTCACTTTCTTCCGCGACTCCCT
AACGCTTCACTTTTTGTCCGTGACACCCCTCCGCCATCCGCCGCACCAGTCCGCGCGGCA
CCTCTTCATCCTCGGGTAACATGCCGGTGCCGTAATCCCGATCTGTTCCGGGACCTCGCA
ATTCACAAATTAAGCACTGCGCACACCCTAATGTGACATGGAAGTCAAGGGGGATCAAAG
TAGTTAAAGCTTTTTTTTGGCACACAAAGGTGTTTTTGATACATCGTATGATAACAGTTG
AAACACTGAAGTCAGTTGGACTGTTTTGGCAATGATTTGGGTTTCTATGGACGTTGAACA
TCTTGGTGCTCTTGTTGTGTATTAACAGGTTACTGAACTAAAATTGTGTTTTTTGTGTTT
ATTTGGACTAAATGCTGTAGCAAAAGAGAGTTTTCATTGAATGAGTTTGAGCATAATGTG
GGACAGTTCTGAATTCAATTTTACACAAAAATGAGTTTGAAAAAAATCTAATCAAATTAA
CTGTACAAGTCACTGTAACTTACATTACACTTTCAGAAATAAAGGTACATCGTGTCACTG
GGGTGGTACCTTTTCAAAAGGTACAAATTTGTACCTAAAAGGTCCATATTAATACCTCAA
GGGCACATATTAGTACCTTAAAAGTACACAAGTGTTCCTCTTAAAATTTTTAGGCACTAA
TATATACTTTTGATGTAGCGATATGGGCCCATTAAGTACAAATGTGTACCTTTTGAAAAG
GTACCACCCCAGTGACAGCTCGCATACTTTTATTTCGAGAGTGTACATTAGACTGACTTA
AAACATCTGAAGGTTGTTTAGCCTAAAAAAAGTTTAAACATTGGCAAATTATTCTATTAT
TCTAACTTAATTATTAAGTTTAGTAAAAAAAAAAAAAACATATTGCTGTGACTTTATTCA
TACAATTTTAACAATAGGCAAGTTTTGGTCAGGGTTTTTTGAAGTCGACTCGGGCTAATA
TTTCTGACCCTGTTTTGATGTAAAATTAATGGAGCTGAAGAGTCAGGAGTCTACATTATT
GTGCATTTGTTGCCTAAATTTACAGTTGGGAAAATTAACAAGGAGCAGATGGGGTTTAGA
TGGGGTATAATGCAGAAATAAATAAAGAAGAAAGAAGGTAATTTTCAAATGAAATTTATA
TATTTTTTTAAAGACATACACGTCGAAGAGTTGGGTACAGAGTATATTTAGGTGTGAGTA
CACATTTTGTAAAATCATCAAATTATTAAAATGATTAAAGTTATTCAAATGAATAATCTA
TATTAGAGTAAAAAAACTTACCCTAAAATCTCACAGTTTTGGGACTGAATATAGTTTGTG
TGTAAGTGAGAGTAAATTTTCATTTTCAGAAAAAATAAGTACTAAAAAATTATAAATAAA
CTAATCTATCCTGCTTGAGAATTTAAGTTCTTGAGCAACGACAAGTTAAAATTAAACTCA
TTTCATTTCAGTGGGGTTCATATACTGGTAATTCTCAGATGAACTGCTCTTATTTCAGTG
GTGTATTCAAATAAAATAAAAAAAAACATTGGTTTTAAAATAGTTTTAACTAATAGTTAT
TAATGTTGTTTAAGCGTAAATTATCTACTATTAGAAGTCTATAGTGAGAATTTGCATTTG
TATTTTAAAAGTTTGTTTGTAATGGTATGTATGTATTTCATATTGTTGTATGTATATTAT
TGAATGCAAATGTTCCTGTTTATCGGCTTGTTAGCTGATTGTGATAATTGACTGCATGCT
GTTTGACTATTTCTGGAGTACTTCCATTTGCAATGCTTTACCTGATGAAGACCATGTCGG
TCGAAACATTGTGACTTTGACATTAAAGATTTTTTTGAGAGCTAAAGTGGCAGTGTGCCG
ATTTTCTTTGGATCTTTTGCTACTAATGTTTGTTTTTTGATCGTGCACCTGCCTTCAAGA
TTTTCTAGATGTGCGCACATTTCTGTTTTTTCCAAGGTTTATGCTTAAATTGACATTTCA
AAGAAAGCTTGCATTTTGTCATTAAATAAAAAGTGAATGCAGTTATAATACAGTTAAAAA
CATAATGTTCAAAACTCTGATGCATTTGACATCCTCTCATTAATGAGAGTTTGCCATCAG
ATTCCATACAAAATGATTTTATCTTTTTAAGAATACTTCAAGAATTTGGTCCAGACGAGA
TTTTGGTGGAAGATTATGAGTTTTCTGTCTATAGAGTTTCTGAGTTTCTAAAGAAATGAG
ATCCGGGAAGGGGGAATTTTTGTATTAACTGTGGAAAGCTGGGATATTATTATGAATGTA
GATATCACTGACAACCAAAATCCTTGCTCTTTGCCAAACATTGAATGCTTTATCATTAAG
TGAAGGATGAAATGCAGGGTTAACAAAATAAAGTGATTTGAAAGATAAGGTGACTGTTAT
AGAATACACTGGATCACAAATTAAGCTACAGATTTTGAAAGACAATCTTTGAAGTGGTTT
CAGAGCAATACCTAAAAAAATGACCACTAGGTGTCACTGTAGAGACGGGTTTCGAAGCAT
CGACAAATTTGTTTCGACTGTGTTTAATACGCTGCATAACCGGTGGAGCTTCGAAAAACG
TGGTTTACCTGTGCTGTAGTGTAAATTACATCGTTTGTCAAACATTTTTAGCGACAAATC
TGAGGGAACTATAGCGGAAGAAGATGAAATCTCGCGAGGAGTGGCAGGCCACTAGCTCCT
CCTCCAATCTTTCATAACAATCCCGGAAACAGCTGGAACATATCTTCCACACCCGAAAGG
AATTTGCTCATTTCGGTATCTGCGCAGCACACAGAGGCACAGCACAACCAATCCAGACAA
GACCCCCAGGCACTATCAGGATGACCGTCAAAGTTCATGTCGTTTACTGGTAGGTTAATG
TACTAACCTACTGTATATTTTGAGGCTTATTCCAGCCAGTGCCATTTTTAGATGGAATCT
ATGACTGATTTATAATGCACTCGCCAATTTTAGTAGAAATTACAGATGTAGAAGTGTTTT
ATAATTGGTTAAAGCTTTTTTTGTTAACTTATTGAGGTAAAGTTGGTTTTATATTCGCTT
GTGACATTTTCCCTTTACTTCGCTACTTTGAATATTCGGTCTGAAATAGCCTGTAAGTAT
GACTTCAAAACAACATTAGCACTATTTACATCGACTGTAAACAGTGTTGAATTTTGATAG
TCATTGCATTGGCTGCTAATATGATTCACCTACATAGGAATCTGCAAAGAATACTTTTCT
TTTAACGTTATTATGGCGAAAGTGTGTATAAAACCAACTTCACCTCAATTTTTATGTTCT
GGCTGTATATGTAGATCAATAACTGTTGATATTAACAAGACGGAGGACATACAGTAGCTT
TGTTTGCGCTTGGCTCATTGTTTGGGTTGTTAGGTGCACCCGCCCATGTTTCTATGCTCA
GCAGGATTTGCAGGTTTATTTGTTTGGATTCCTGCATTCACTGATGTTTTCTTCACAAAC
GAATGATTACGAGCTATGCATGGTAGCTTAAAGGACTGGAATCAGAAAAATCCTTGTAAT
TTGTGAACAGTCATAGGTTATAAAACATAGCTAATATGCAAATTACATTTTGACCAATCA
GGTGAATATTATTTAAATATGTCTGTTTGTCATCTCCTAGCGGCGGATGAGGGTACCGGC
CCAAGGTAAGTTTCTTTCCCCTCAGTTCTTATTATCAAGAGACAAATACCCATTATTTCC
TATCGTAACTCACTCAAAAATAAAAAGTGTTCCTAAACTTTTATAAATTTCTTTCTTCTG
TTAAAACACAAAGGAAGATATTCTGAAGAATTAGTTGATACTAAATGTAAATGTAATGTG
TACTGTAAAAACATACAGAGACTCATAAATCTAAGCCTCAAATGTAATTTTCTAAAGCTT
CATCTCCTGCTTTAGAAAATAAAGCTTTAAATTGCAGATGTATATGTGAACGGTAACACA
TTCAAGGTTCATTAGTTAATGCATTTACTAACATGAACTAATCATGAACAACACATGTAC
AGCATTTATTAATCATAACTGAACATTTACTAATGCATTATTAACATCCAAGTCCATGCT
TGTTAACATTAGTTAATGCACCATGAGTTAACATGAACTAACAATTAACTACTGTATTTT
CATTAACTAACACTAACATGAACAAATACAGCAGTAAATGTATTTTTCATTGTTTGCTCA
TGTTAGTAAATGCATTAATTAGCATTAACTAATGTACCTTATTGTAAAGTGTGACCATGT
GAACAATATTACACTGGTAATGAGCTCTATATCGGCACTGGTAAGAGGCAATATACAGCC
ATATCTCACTGCTATGAGTGTGATATTGCATTCATACAACAGTTAAACGGCATAATCATG
TGTATAAAAAAGAAAATCAAACACACAGTCTAAAAACCCTTTCGTATGAGGAACTACTTT
CTTTCAACGTTCATTCACATCTGCAGTTGTTGTCAGAACAGCAGAAACAATTACTAATTT
ACCAACATCACTTTAGAGCTAGTGTTTGAATTATTCTCTAGTGTAATGTCTAAAGTGAAG
ACAAAACAGGTAATTTTGCTCACATTAGATTATAAAGCTGAACGGCATGAAATGCCATCA
GTCTACAGAGATATCCCAGTATTTCTCTGTTGCAATCAGGAAAAGATAATAATTAACCCC
AAAAAACCAAAGCAAACACTACCAGATTACTGTTGTGTTTGCGATAAGGAACAATGCACA
TGCAGGCATTTCTTCTTTTTTTTTTCTGTGTACTGAACTAGTCTGCAGTAACGTTCTCAC
ACTCGATACACTACAATTACTATGCTATAAATACAGCACTGCAACATACAAAAGAGAGAG
ATCAACTTAGAATAACACTTACCTGTTTAATAATGATTTGATTAGCTGGAGTCAGAAATT
ACGCTGAGTTTTTCTTTTCTAAGGGCTTCTTATGCAGTCTCTGTCGCCATCTTGTAGATG
AACCATGTCAGCGTCTTTTCTCTGGCACTACCCTTATACATGAACTGTTGCAATTTAAAC
AACTTCATTCTCACATGAGAAGCCTCAAAAGTACACTATGTTGTCCAACAGCAGCAACAT
TTGTGAACCTGTAGTGAGTTTATTGATCTGCTGTCACTCTATGTGGGCGGAGTAATACAG
AAGGGTGAAGAGGCTGTACAAGTGCTGTTATCATGGGAATATGGCACAGCTATTAGCCAA
TCAGATTAGAGAACCAGACAGAACTATTGTGTAAAAATGTGTATATATCAGAGATAAGTC
ACTTTGCTTGTAGTTCATTGATTTAATCTGATATAACTAGAATATAACCAGAAGCAGGTG
AGCCACGTACCCAGCAAACATTTTTTGTGTCTAAAAGATGTCTAAGCATAGATGGCTTGG
CTGAAACATAGCTTACTTTAGGCTGTCAGTGGAAATCTATTAGATGTCTAAGAATAGCTA
TTAGTGGAAACAAAATACTGTGGAAGGCGATGAAGAACATTCTTCAAAATATCTTCCTTT
GTGCAACTAAAGAAAGAAACTATAGTGGAGGCTAATGATGACATCATTTTCATTTTTGGT
TGAACTATCACTTTAATATAATAATGTTATATTTGTTTTCTGTTTTGCAAACAGTTCATC
AAACTCAAGACGTTGCTTGAGGATGAATTCCCCAACGAACTTGAGATTGTATGTCATTTA
AATAATTTTATCATGACAAACCTTAATGTAAATCATTTATTAATATATGTGCATGTTCAA
TTGCACAAAGGCTTGTTGTCTCCTGATTATCTTTTCTGTTGTACTATGAATTCCCCTGTG
CAGACTGGTGAGGGCACACCCTCGACCACAGGCTGGTTGGAGGTGGAAGTAAACGGCAAG
TTGGTGCACTCTAAGAAGGTAAGTATTGATCTCTCACTCGCTCTGTTTACTCCCATAGAT
CACAGTTATATATTTTTGAATTTGCCATAATATCATTATCATACCATAATGAATTTACCA
TTATTTCTAGCCTTTTCTCAGGCACCGTTCACACTAGTGCGTTTTAGTTCGAAAACACAT
ACGTTTTGCTAAGGTTACGCCATCCGTCCACACTACGCCGGAGTTTGAGCGCCAAAAATA
GAGCGTTTTGAAAATGCTAGACAGGCCGCTTTCATTCTGAAATGCTGTTGCTCCATCTCA
GTGTGGATGGGGGAAAACAGAGACATCTGAAAACGGAGGCGTGGCTGCTGAGATTCGCTA
CCTGATTGGGGCTTTTGTGTCATTGCGTATCCTTCTCTTATTCATCAAGCCCCTATCACA
TGACTATAACACATGGCTTTTACGCTACCGGAAGACAGCAGACCAGCCTTCACTGTAAAC
AACAACATGGGCACAGAAATGGGAGCGTTGCTTGCACTATTGTCTGTTTTAGGCGCCATT
GTGCAGTTATTCATTTGTTACGTTTAGTAACAACTTGCCCTCGTCGTCTGTCCACAAAAA
TACCTCTCTTGCTTTCTTTGCCATCGCGTTCATTGTTCAACCGGAGTTTGTTGACTACCA
ATAACCAAATGCTAAGCGAGACACACACTTCCTGTTTATACTAGAACGCGCATGGCCAGA
GTGCGCGAATGGTCACGTGATACACACTTTTGGTGGAGTATTGTGGACGGAGATATGTTC
AGAAACGCTAGGTGAAACGGTAGTGTGGACGCAGATTGTTTTTGATCTAAAACGCTGTTT
TAATACAAAAATGCTCTAGTGTAAATGGGGCCTCAGTTTCTATGTTAAATTAGGCTGATT
TATACTTCTGTGTCGAGTGATTGGCATGACCAACGCTGCCTGCCTTGCGCGTAGTTATGC
ATTTATGTCGAGTTTTTCGCGAACGTTTTGTTTTTTCTGAACGCTACAAGTAGCTAAAAC
TCACTCATTCAGAGGCGGGAACCGGTGTTGCGAGATATAGCTGACTTTTTCCAGCCAAAA
AACTGTCCAAAACCTGCCTTAAAGCACTAAAAAGCGCCCAGAAAATCAGTTTAATAATTA
ATTGAATTTAATTTATTTAAATGTAAATTAACCTAGTTACTTTAACTGTCATCATATTTA
ACAATACAACAACCAACTCCAGCAGTCACAGAAGCACAACATAACCGGATCACATTGAAA
CCCTTCCTCTTACCCCCACACTGCACTTAATGTTGTGTAGAATACACTACCTATAATGCT
GTGTTTACACCAGATGTGGAAGAAGCATCAAGTGTGAGTGATTTTACATGTTAAGTCAAG
GCAAAGACGCGAATAGACATCCTGCGGCGCGAATGATGCAATCCATGCTAACGAAGCAGC
TCGAATTGAGTGTTTTGTGCGATCGTAGCTAAAAATCTAAAACCCACCAAAATGCAAAAA
TACCCACCCAGTCTTCTGTACTCACGAAAATCACGTCAGTGACAGATTTTGAGCAGTAAA
TTACAGATTGTAAGCATACGTTTCAAACACAATAATTTAACATCAAAATTATCATCAGCA
TTACTGACCAGGACAAATCTAAAGTCTGTTCAAGTCCACCATTCTAAGTCTATACAAAAT
TTAGCATTTTAACCAACCACAGCTACACAAAGCCTATTGCTGTTTTACCACATGTGTGAG
AATAAGAATAATAATAGCCCACTCATATTAACCTTTATTTTATATCTACAGTATTGTGAA
AAAAATCGTGATCTTTATTTTAGGCAATAAAATTTGCGATTCTCATTTTAGCCAGAATCG
TGCAGCTCTACTACACGTGAAAGGGAGTCAGATTTGTTTGGGAGTCAGATTTTGATACAA
CTTTCCTTCACCTTCTCTTGCGGATGGGCCAACGCGGTTTGTGCTATGCACTGGTCACTA
ATAACTGAATGGAGTAGGAGCACACAGTTCTGTTTTGTTAAATAAGTTGCACATAAAACG
TAAGTTTCAAAACCGCCCAAATTTTGTCAACTCGTCAATGCCATTTTGTTTTACCCTCAC
AATCAAATTTAAAACTGCCCAATCTGGCAACACTGGAACTGTGGGATGTACAGATTTAAT
CATAAGGTAAACACCAAACAAGTCTCCATCTGGAGCTTCTTCACTAGACTCGACACATGT
AAACACTCACTCTGTCAGGCTTGTGGCTCTCAGCACCGCCCAATCACAGCTACCAAGCCG
ACCAATCATAGAGCTTGCCCTATGCGTGGTGGGTGGTTACACTTTTTGAGAGATGCGCAT
TAGCCATGGCGAGAGACCATATGCGTGCACTTGAAGTATAAATCAGCCTTTATAGGGAAA
TCAAAAATGAAAACTCACTCAGTATTTACTTGCCCTCAAGTGGTTTCAAGCCTTTTTGAG
TTTCTTTATCAAACACAAAAGATGATGTATTGAAGGAAGCTGACAAATGGTATCCATTGA
CATCTAAATAGAAAAAACAATACAATAGAACTCGATGGTTACCAGTTTTCAGCATTCTTC
AACATGTCTTCTTTTGTGTTAAACAGAAGAAAGTTAAACAGGTTTGGAACAAGTGCAGGG
CAGTAAATGATTTTCAGCGATCCCTTTAGCTATTGCCCAGTGCAGTGTTCATGACTGAAT
GTTTTGCTATGCAAATCTTGTTTGGCAAAGTTCATGTCTACAGTACTTTACATGTAATTT
GATCTTTGACAGAACGGAGATGGATTCGTCGACTCCGATTCAAAAATGCAGAAAATCGTG
ACTGCCATCGAGCAGGCCATGGGGAAATGAGCATGAACTGATCATAGAGGGTAATAAAAC
TCACCATAAGCTTTTTATTGTAACATTTAAGCAAATGAACTCCTCCTTTTCTAATTCTGT
TCTGTGTTGCATTTTCACAGCAGTTTTTCTTCTCTGTTTGTGGGACTCCTGGGTAGTGCA
ACAATGATGGTGACGTCCAAAGTGTTTCGGGCACGGATGTTGCTTGATGCTCTCCGCTCT
TCCCAGGAGAAGATCATCAGAGCAGGAAACTCCCTGTGTAAACGGCTTCAGATTAACGAT
TTAATGGTTGAAAACAAAAAGGGAAATCTTTCAATTGGACACAATTTGTCAGAACGTGTT
AAATTAATGGTACTTTTGACCTGATCTTTGTTTTTCTCAGTATGTTTGCCTTTGCTACAA
CGCACAACTTTAGGGAATATTTGGCATTACTTAAAACTTTAAAGCAATAAAGGATGTTAC
TGGCTTTGTCTTTTTGTTTATTGGGGCTCGGCATCTTTGCAGCACAGAATTCTGCCAAAC
ATTAAATATATATATACAGCAGGGGAAATGAGTATTGAACATGTCATGTTTTTTTTCTGG
GAATAATATTTCTAAAGGAGACGTTGACATTGAACCAGATTCGGGTAAAAACACAAACAA
TACAAACATGAAAATAAAACAAAACAAAAAATGTGATGACAAGGAGTAACTACTGAAATG
TATTTCATACTTTATATAAAGGCTTTTTTGGAGCCAGTCATATGGAGAATAAAGTCACAT
TATTTTCTCAGGTGTGATTTTTTTTTTTTTTTTTTTTTTTTTTTTTGACAGACTTGTGTA
AAAATCTTGATGTTTCTGTAGGTCTCATCTATCAAATCTGGTCTTTAATTTGTATATTCT
AATGGATTCAGGTCAGGGGATTGGCTGGGCCATTCTACAGCTTGATTTACTTTCTCTGAA
AGCATTCGAGAGTTTCCTTGGCTGTGTTTTGGGTCATTGTCTTGCTAAAATGCTGGTTTC
ATCCATATTATCCTGATAATGTAGATGTAGGACTAAAGCAGCTAATATGAATTTACAATG
GCGAAGGGCAGAGAGTTGCCGAAGAACTACTGAGAGATTTCAGCTGCTGTCTGGGCTTTC
CATGTCTTTCTACTCCCCCCTTTCTTCATGTGTTCAATACTTTTTCTGTGTGTCATTTCA
TTTTATTAAGCATAACTTAAATTGTAACATAGTTAGATTTGTTTTCTTGGCATATATGGA
TTTCTTTGGTTGTTACCAACATCCAGGGAAAATTTCAAGTCACCGGCTCCTTTAGAAATA
TTTTTTTTCGGAGAAAAATGGTGACGCGTTCAATACTTATTTTAACACTGTCACACAAAG
GGTTGTATAACATGTCAAAATCTAAAATGACCCAGAATATAGATCATAAAAATGAAAATG
TAAATGGGACATTTTTTATAAACATTTCCTCGTAGCAGTCTTAAAGTAAGAAGCTGTCAA
ACTGGTGTGAACAGAGAAGAACTGCCACTTCAAACTCTGAAGCAAACGGTGAGATTTGGT
TGAAGATTACCAAAACAACCTTTTTTTCCCAGTAAATTAACTTGCGAGGATTATTGATCA
CCTAAAAAGTAACAATGTGTGCTAATAAACTAGGTAAATTCTGATTTCATACTTAAATCC
CTTGAAAATATTCTGCAGTCTTTCGATTATATACAAATAATCCTTTAAAGGAATAGTTCA
ATGAAAACTATCACAAGCCTGTTCTTCCTTTTTTAAAACAATATGATATTTTGATAAATC
CAGTATGCATTGACATCCATACTATTTGCTTTTTCTACCATGGATATCAATAGATACTGT
AAACAGAGTGTCCTGACCTTTTATCATACTTGTCAGATTATACTACCAAAACTATTTGAA
TAGTTCTGTGGTTGGGGTAAGTTATGGTGATGTTACAGATTTATATCACATCGCTACATC
AAAATTTAACCTGAAAGTGGGACATCAGTAGCAAACAGTCAATCACATGCTTTAAATTAT
AACATTACTGTGATTGACATCTTGCAATATACTAAACCAGTGTTTCTCAACTACGTTCCT
GGAGGGCCAGCTCAACACATTTTCCATGTCTCCATAACCAAACACACCTGATTAAGATCA
TCTGCTTATTAGAAGAGACTGAAAGACCTGTAATAGCTGTGACAGACAAAGGAGACATCC
AAAACATGCATTGCTGGTTGTCCTCCAGGAACGTGGTTGAGAAACACTGGACTAATCGAA
ATTCAGAAGCAATAATGGTTTAAAAATACGGGAAAATTAAAAACATTTACTTTATATAGC
AAGATGAAAGGAGCTGTCCACCAAAGAGGAGAGCTAAAAGAAAACAGTCTGATTTATATT
GTAAAGTGTATGTAAGTTTGTAAAAACAGTTGTTGTTCATGTGTATACAGAGACTCAGAA
GCCTAAGCTCATCTGTAATCTAATTCATTCATTTTCCTTCAGCTTAGTCCCTTAGGTTGC
CATAGCGGAATGAACCGCCAACTATTCCAGCATATGTTTTGTGCAGCGGATGACCTTCCA
GCCACAACCCATCACTGGAAAACACCCATGCACTCTCATTCACACACATACACTACGGCC
AATTTTTGGTCACCCAATTCAACTGTACCGCATGTCTTTGGACTGTGGGGGAAACCCACG
CGAACACGAGGAGAAACATGCAAACTCAGAAATGCCAAATGGCCCAGCCTGGACTTGAAC
CAGCAACCTTCTTGCTGTTTGGCGACAGTGCTAACGACTTAAATCTAAAATTATATATAA
TTGATGGCGGTTCATTCCACTATGGCGACCCCGGATTATTAAAGGGACTTAGACAAAAAG
AAAATGAATGAATATATAATTAAACTCATTTGTCGATTAATAAACTAAAATTGCTTTTGT
CTAATGGATTAAAAATATAATAATTATAAATCATTTAAAAAAATAATAAATAATTCTCAA
TCACATCAGAAGATTTTAATCTCTAAAACTGTTAAACTAAATAGTGAACTTTAAATTGGG
GCAAGGGGATCGGGAGGAGTGGCTTCATTGCATCAGAGATGTGCACTTTGCTTATAGTTG
ATTGGTTTGTGATCTCTAAACCAGACTATAACCAGAAGCAGGTGAGCCACGTAACCAGCA
GGCATAGACTGCTAAACATAGATGGCTTGGATAAAACAAGGCCAAAATTTGTCTATCAGT
GAAAATCTGATAGATGTCAAAGAATAGCTCAAAATGAAACACACAATGAGCGAACATCTG
TCACTCACATCTGTCACATGCGTAACAGAGATTTTCCTCATAAATGCAAAAATTCTTATA
TTTTATGTAAGAATAAGATCCAATTTTCTCCTTCTGATTAGTATTATTTATTTTATGATG
CGCAGTTTAATTCACAGAATATTTAGTATGTGAGCCTCACAAATGTTTTGGATCACTTCC
ATAACGCATGTTTATTTTTCTCGTGTAAAATATAAAACGTGTACATGTTGATATTTTTCA
GATCCCTTAGTTAACTCTGTGAATAGTTGTTTGGAATATATAAACAGATGCTTCAATATA
CTGTTAACATATAACCACATTCTCTGTGAATTTATGTTTCAAGCTTGCCACAGAAATTAC
ACATCCATAATGCTGTAATGGTTCCACAGTATGGACATACACTCACTGGTTACTTTATTA
GGTTTACCTGTCCAACTGCTCATTAACGCAATTTTCTAATCAACCAATCACTTGACAGAA
ACTCAATGCTTTTAGGCATGTAGACATGGTCTATGTCTGGGGAATGGGGAAAAAATGTGA
CTTAAGTAACTATGAACGTGACACATGGATAATGGTGCCAGACTGGCTGGTGTGAGTATT
TAAGAAAATGCTGATCTACCTGGATTTTCAAGCAAAAGCATCTCTAGGGTTTACACAGAA
TGGTCCGAAAAAGAAAATATCCAGTGAGCGGCAGTTCTGTGTGGGCAAATGCCTTGATGA
TGCCAGCGATCAGAGGAGAATGGCCAGACTGGTTCCAGCTGATAGAAAGGCAACAGTAAC
TTAAATAACCACTTGCTACAACCAAGGTATGCAGAAGAGCATTTCTGAACGCACAACACA
TCAACCTTGAGGCAGATGGGCTACAGCAGCAGAAGATCACACTAGGTGCCACTCCTGTCA
GCTAAGATCAGGAATCTGAGGCTACAATACGCACAGGCTCACCAAAATTGGACAATAGAA
CATTGGAAAAACATTACCTGGTCTGATGAGTATCGATTTCTGCTGCGACATAAGGATGGT
AGGGTCAGAGTTTGGCGTCAACAACATGAAAGCATGGATCCATCCTGCCTTGTATCAACG
TTCCAGGCTGCTTGTGATGGTGTAATGGTGTGGGGATATTTCTACCTGAGTATCGCTGAC
CATGTCCATCCCTCAATGACCACAGTGTACCCATCTTCTGTTGGCTTCTTCCAGTAGGAT
AACGCAGCATGTCAAAAAGCGCAAATTATCTCAGACTGTTTTCTTGAATATGACAATGAG
TTCACTGTACTCAAGTGGCCTCCACAGTCATCGGATCTCAATCCAATAGAGCACCTTTGG
GACATGGTGGAATGGGAGATTTGCATCATGGATGTAAAGCCGACAAGTCTGCAGCAACTG
TGTGATGCTATCATGTCAATATGGACCAAAATCTCTGAGGAATATTACCTTGTTGAATCT
ATGCCATGAAGGATTAAAGCAGTTGTGAAGGCAAAAGTGTGTCCAACCTGGTGGCCTAAG
GTGTATATAATAAAGTGGTCGGTGAGTGTAGATAGATATACAATTTCACTGTAAATTATA
TATTCACATGAACTTATTGAATAAATAAATTGTGAACAAAAAATTGTTTAATACTGCACA
TCTGCTACATACGCTAGTCAGTTTTGGCTAGTGTGTAGCTAACTACAAGGCACAACATGA
ATGCAGGACGCTGCCGTCATATCATTTAATAAAAAAATAGCACCCTT
Chart Advanced