SelenoDB
Release 2.0
Chart Advanced
Sequence Report for SEQ00000513_2.0
Identity
SequenceGlutathione peroxidase 4a (GPx4a)
SpeciesDanio rerio (Zebrafish)
DescriptionGenome -assembly-
Sequence IDSEQ00000513
Sequence release2.0
External IDNone
Gene SPG00000514_2.0
Annotation
Prediction method(s) None
OrientationReverse
Toolbox Forward Reverse  
Sequence
>SEQ00000513_2.0 # Sequence # Glutathione peroxidase 4a (GPx4a) # Zebrafish 
TCCCCCCTATGATATACTAACCGATTATACACCAGTGGATTACACTAGCTGGGGTTTGAG
TATTATAATCATTCAAAACAAAAACAACTTCTATATGCATTATGGTTCCTATTCAAATAA
TTTAGGACAACAAAACATCATAATGATGCCATCTTTCAGTCATTATAAGAATGTCAACCT
TCATGCAGAATGCTTTAATTCATTCAGCTGAGTACATGCAAAAGTCATTGATCCTCACCA
TATGCCATGCAACCCTTTACCCCAATTCTCACCTCAAGCCCCCCTCATCCATCTGTCATC
AGCTCAGAGTCCCTGCTATGCTGAAGGCTAACTAGCTGATGCTGACTTTAACCTGACATT
TCACAACATCCACCTGACGACATCCATACTAATCTGCATTTATTGTAAATACACACTCCC
TCGGTCTCCACACGAGCCATAATAAGCAAACGCTCGCGTGACAAATAATCACGCATCAGG
TCCCACATCCATGCTAGTTTTGCTAGCTCTATCCATGTGCATCCCAACACATATGAATCA
CTCAGATATGATTGGATGAATAAATGTGTCCATTAAGCCGTATTTTGAATCAGAACGAAT
CGGTTAGTTACCCGCATCCACGTCGTCCGCCGACCCCGCGTCCTCGGATGCTGTTGCCCC
GGATAACGGACTCCCATCCCCGGCCTCGGACAGACTGGCCGCCCCTTCAGCCGCCGCGGC
TTCCATTCAACCTCCCTGGATGAATCCTCCGAGCTAAAGAGGGTAAATAATTTCTAAATA
AACACAGCCTTCGCTCGCTGTCTGTATGGATATGACTGAAATGAATGCGGGAGGTTGAGG
AGCGTCGCGGTCCTCCTGCTCTCCTCAGCTGTCATGCACTGGCTTTGGGATGATGTGCGA
TTCACGACTCTGGTTCGTTTGAACAGGTGGATTGGTTCAGTAGTTCAGTTGAACCGACTC
GCACACTTGCATGTTATTTTGAACTGTTTAGCTTTTTAAATAGTAAATATAACGAAATTT
GGATAAACATTCGGATATATTAAGAGTTTTACAGCGATACGTGTAGTAATGTGGTCAATT
TTGGCGTAGATAAAACATTTGTTTTGGAAGAGAAATGGACACGATTGTCAAGTTGAAGGA
ATTGAGAATGATAAACAGCAGACATGTTAATTTTGGTTAATTATAAAGTGCACTGAGTAT
AAGGAAACCAGCCTAAATATATTTTAAGTGTTTCTAATGTCATATTTTATCAATTTGTGA
CACACTACGCATGTTTTTAAGTGAATTATTTTTTTATTTATGATTTAATTAACATTTTTC
CATTTTACAAACATATCAAACAACCCTTACAGAAATAATAATAGAAAAAAATATATAAAC
ATAAATACAAATAACATATTGATAAAAAAGTGAATAAATAAATTAAAATAAAAAAGAAGA
TAATAATAAAATAAAATAAAATTAACAATTAATGCGAGGCAGATGTCTACATTTATACAG
TAATCTCAAATGTTACATTTCGAGTGATGAAAGATTACGTTTTTAAGTGAATTAGCATTA
TTTTTTGTCCTGCACTGAGTCAATGCCTGCTTCAGTTGCACTTTGAGACACCAAACTTCA
GATTTGATAATATATGTATTCTCACGGTTTTTTAGAGGTTAATAAGTAATTTGCCTAATT
ATAACTATATTACATTTGTAAAAATTTAGTGACAAATGCCAAGACATTTTCTTAATTAAG
GATACGACACGTCGATGACTATCAAAAAAAATGAATTGTTTTGATTCACTAACGCGAACC
AATTGAATCGATTCATAAAAACAAATCGCACTTCCAAACGAGCGCACTAATCTGCTTGGA
TGAGGCGCCTGCTGCTCTCTGTTGGTGAATATTCAGTAATGCAGGTGAGAAAAAAAAGCT
TAACTCGGATATACTATATCAGGGGTGATCAAAGTTTTTCTTATGAAGGGCCAAAAAGCA
AACTTGATTGAGGGTGGTGGGCTGAAGGTAAAAACACCAAACTGTATTACGTTAAAGTTG
CCATGGGTAATTTCCTCATTTATATAATAATCTAAAAAAATAACTAGAAAACGTTGCTTT
ATATTAACTAATACAGTACTTTTTTTTTTTTACATTTGATAACAAACTTATTATATTAAA
AACAAAAACAATCCCATTTATAACAGAATGGAGTTCCTCGCCTAGGTTTTCTGCATTGTC
TTCTGTCCATCGAGTGATAGTAAGTACATTTTAGAAAATCAGATTCATTTATGGATACAT
TTAATTGAAACATTTAGCTAGCAATCAGTTTATTTTTTGTAGCTAAGCAATTAAACAAAC
AAACAAACAAACAAACAAAAAGGTTGTATGAAATTAAAAATGACAATCTCTGTTTAAGGC
ATTTGCCCCTCCCCTCCCCATCACTCTCTTCTCTGATGGGATGGTGGGCCAACTTTGGCC
TGCGTTTGGTAATCTCTGAGCTATTTCATCATTAAATGTGTTAAATTATTAAATATATCT
CAATATTATTAAAGTAAAATCTAATATAATCCTAAAATCTAATCTAATGTATAATATTTT
ATTAATGTTCAGTTAATTCTGATGTTCATGAAATAATCTGGGTAATATACTGTACAGTGG
TGTAAAGTAACTAATTACAAATACTTAAACTACTGTAATTAAGTAGTTTTTATCAGAAAT
TGTGGTAGTTTAATTTTTTTTTTACTTTTAGTGTAGTATCGGTACTTTTACTCCACTACT
TCATAATGCATCATAATGAACTACCTCAAGACATGGGCGATTTGTAATTGCAGCAAACTG
ATTGGAAGTTGTCCAAAATCTTTACACACATTAACCGAGAGACTGTTTAGATGCATGTCA
CTGATAAGAAGATGTTTACAATGACCGAAATCCCCTAAACACCCAGCAGGCACAGGACAT
CAACATGATGTTAGATTGATGTTGTACCCCAATGTTGTGGAGACACTGCATTTTGTTTAA
AAATGAAAATCAGGTTGACGTCAGAACTCAACGCCAGGTTAACATCAATGTCCAACATCC
AATCAAAAATCAACAAAATATCAATGTCTAATGATGTTACAGCTTGATGTTGTGTGGACG
TTACCAATATGACGTCTGCCAGACATTGAATTTCGGTTGCCATACCTGACGAATAAATGT
CAGTATTTAACGTCAATGTGATGTTGGTTTAAGATATTGGTTCGACGTTTTGGTCACTTT
TCAACACAACCCAAAATCAACCAAATATTAACGTCATTTCACGTTGTTATTGAACGTCAA
TATAACGTTGTCCTTAGACGCTGACTAGACATTGAATTTTGGTCACCTGACATCACAACC
TATATTTAACCTAATATTCACGTCTTATGACGTTGTGTGCCTGCTGGGCAATAGCTAAAT
GCACTACAGAATGTTACGTTTACACACATGTAGATTAGATGTAAATGCATCATCTTTTTA
CTGTGCAATACTCACTACTTTTGAAGTACTTTTGAAAGGGCTACTTTTTACTCATACTTT
GAGTAATATTTACAACAGATTCTACTTGCACTACATTTTTAGGCAAGTAATGGTACTTGA
TTGGTCACTTGAGTATGATTTTTCAGTATTCTTTCCATCACTGATACTGTATATAGAATA
GGCATGGGCAGGTATAAGATTCTGACGGTATGATAACCATGCATAAAAATATCACGGTTT
CACAGTATTGTGGTTACTGCTCTAAAATATGTGCTTTTTAAATGTCTTGGTAAAAAACTA
AAACTTTTTCCTCTTTGAACACAACATATTTTATGATAAGAAACATTTAAAATATTTTGG
AACAGTAGCTAAAGATATCAGGCTAAATAATTTAGACTTCTGCTGTCTTTGTTTGTTTAA
AAAACACTTATTTCTTTACTATTTAAAATGGCATCTTTGGATATATCGTCTCTGCTGGAG
ATACTGTTGTCCTAAAAACATTTTTTAAAAATCTTACATATTCCATAATTATATATAATA
TGTATATATGTAATCAACCAAATATTAACGTAATTTCACGTCGTTATCGGACGTCAAAAT
AACATTGACCTTAGATGCTGGCTATATAAAATACTTCAAGCTTACTGCAGGATTTTTATA
GTTGACTCAAACCGAAAATTAAAAAAGCTAACTTTAAATAAACAATTACAAAATATTTAC
ATACATATACTCACATTTCAACATTCCCATTTCTAATTTTCGTTCTGTTTAACTTATTAA
AATAACTAGAACAGACATAAAAAATAAAACTTAATAAAAAGGATCAATAAAATTACTAAA
ACTTTAACAAACTACTTAATAAAACAAATACAAATTAAATAAAAAAACACTATAAAACTC
AACAATACCTTGGCTTACAGGAAGAAAACAAACACCAAACGTACTGTTCAGCAGAATCTC
TTTGCATTTATTAATAAATGTACACTACATCAGCATGTTTAGTGCTAATAAAAAGCATGT
CTCTTCATCTGTCCTCTCTGCGGACTGACGCTGAGCACTCGTGATGCCCTCAGGAGGAGG
TGCACGCCAAACACATCAGGTCTGTTCTTTCCTCAACAAGGGGTTTCCAAACAAACCTTC
ATCAGTCCATGAGCGGCATCACTCACACCCAGCGCTCAGACGCTAGTTCAGCTCATCCAG
CACATTAGAGATATTTAGAAAGATCCTTCTCCACCACCTGAAATTATATTTAAAGACAGT
TACTTACATGATGATATAGTTCATGACTTTAAACAGATGTAGATATAATTAAAGATGAGA
AGAGAATGAGAAGCGTACACTTGGATCCTGCAGTGGGGAGTATCTCTTCACAACCTGGCC
TTCACGGTTAATAAGGAACTGACATTTAGACAAAAAGGAAAATGATTAATTAATTATAAT
GAATAGTAATCATTTATTTGGATTTATTAATTTATTTTAATAAATTTAAAACAGTAATTT
GTCTATAAAAGAAATGTACAAACCTTTGTGAAATTCCATTTGATGCCACTGTAACAACAA
AAAAAGTCAGCCTTGTTGAATTTACAATTTTTAATCCTAATTTTAATTTGTGATAATTTG
CTTAAATCATAATTCTAACCCCCGGTTTCACAAACAAGGTTTAAGGCTAGTCAAGATTAA
ATTGCATGTTTGAGCTGTCTCAACTCAAAATAACTTGTAGAGAGATGTCTTAAATATGTC
AGTGTCATTTTTTTGTTTTCCAGGTGCACATCAGTAATATTTTTCTAAGGCCATTTTTAT
AAATGTGTCTTAAATAGCCTAATTTAACTAAGGCCTAGTCCTGGCTTAACCTAAGCCCTG
TTTGTGAAACTGGGCCTAAGTGTTCATCTGAAATAAATGTGTCTTGATTTTCATAATTAT
GACAATTATATTTTATTTTAAGGGCACCTATGATGAAAGCTTTTGTAAGCTGTTTGGACA
GAACTGTGTGTCGGTATAGTGTGTCCACTGTCATATTAAAGTGATAGAAACGTTGTGATA
GAAAAAGTCTCTTTTTGAAAATGTCCTGACTTTAAAATAGGACCCAAATCCCAGTGATTT
TGAGGCCCACCACAACGTGACATAAGAGTGAGGTTTTCCCCGCCCACTGAATAGATTAAC
AGATGCCATGTTTCTATAAAACACACACTATTGTAAAGTATGTAAAGTATGTTTCTATTG
CACACACATCTCCACAAAACTTTTTTTTTTTTTGCAAATAAAATGGGATTCAAATATTTG
TTACAACTCTCTGTGGTTTTCGTAAGTTTTATAAGAGTGTAACGTTTTAAAACAGGCAGG
GAGCAGCAACTCATTTTCATTGAAAGCAAAAGGCTACGAAATCAGCTACACTGTACTCAG
ACACTGATGGGTGTTTTGAGCTGAAACTTTACAGACACATTCTGGAGAAACCAAGGGCTT
ATCTTACATCTTGTTAAAAAAAGGTTTAAAAAAAGGTGCCCTTTAATTGTCATTTATGTT
AAACTGTCATTTATCTCTATGATTATGTCATAAATGACTAAGTATGTCAAAATTTCAATG
TTATATATCATTAATAAAAATAAAGATATTCAAATATCTTATTTTCCATTTAACAGAAGA
AAAAACAATCAAAGTTATTTGTATTATTGTCATCTCTTTTTCTAATAATTTCAGCATTTT
ATGTTGTAAATAAGACAATTCTTCAAAATATCTTCTGTAAATATCTAATGTTTAACTTTT
TCTTAAAGCTAGTGTTTTATCTCAAATAATATTTTCTAAATTTGTCAAAATTTACTTTTA
TGTTGTAAATATAAAAACATACTTTAAAATATATAAAAATTCCAAAACTATATAATAGTA
CTAAACATAAAAAAAAATACCAAATAGAAAAGCCAATCTAGCAACTCACTTTCCAAGGAA
TCCTTTTCCATTAGGCTGATCCTTCAGCCACTTCCAGAGCGGATGAGCCCCGTCGCCATT
CACATCAATCTTGCTGAACATGTCAAACTCTGCATTGTATGACTTGGCGAATTCCTTGAT
TTGGGAATTAGTTCCTGGTTCCTGAATAAAAAAAAATATTAGATAATAATAGGATGTATT
AACTTTAAAAACATTAAATAAATGCACTTTTGTTTGGAAATAGACTCATTTTACAACTCC
TCTACAGTTAAACAAACTATTCAGCCGATCTCTGTGTCTGGTAGAAGCACTTTTAGCTTA
GCATTAAATCAGATTAAACCATTAGCATCTCATTCAAAAAAAAGTTTAAAGGAGTTTTGA
TAATTTTTCTATTTAAAGCAACTTTTAATATTCCATCAACAAAAGATTAAAGCAGAAAAT
AGAAAAATTATCAAAACTTAAAAAAAAATGTTTAAGTGAGATGCAAATGGTCTAATTCGA
TTTAATGATTTATGCTAAGCTGAGCTAAAAATGCTCCCGCCAGACATGTAAATTGGCTGA
ATGGATTCAAAAATGGTAAAACTCAGCACTTTAACTTTAGATGATTTGTAAAATGAGCCT
ATTTACAAAAATAGTTGAGCATTTTTGATGTCCATACCTGACGTCCGAACTGGTTGGAAG
GGAAAGCCAGGATGCGTAAACCTCTCTCAGAGTACTTGGCGTGCATCTCTGCAAACTGAG
AGTAGTTTACTGGGGTTTTACCTCATTTGGAGGCAACGTTTGTGATGATCACAACTTTTC
CCCTGAAGTATGTAAATATGAAAGTAAATTAGTGTCACAAAGTCATTGGAGCAAGAAATA
ATATGCCAAAAGGTTTAAAATACTGTAACATTGTGATGATTAAGTTGTTTCTAACACAAC
AATTTGGTTTTAGCTGCTAGAAGATGCAAACTATGTGTACAAAAATTGGTGCAAAATATA
AAACATGCTTGATATCCTCCAATTTAATAGTCTGAAGTAAAGAAAAAAAAGAATCATACA
CTACTCAACTCTCTGTGAAATCTACAGAAGTCTCATGTAAAAACAAAAACTTTAAACCGT
TGACCATGAATATGACTTTTATGGGGTGGTGAGTTATAAATTTGAGATAAAACAATTACA
AAAGAAGATTTACATACTACATCAGACATAAAAAGATAACCATAATTTGGGAAAAACATG
AAATGATGGCTATGACTGTGAAATGATGACTGTGACATGTAATAACTATGACATAACAAG
CTTAAATTATTAGATAAAACCATACATATGACAGAAACATTTGGAATAGACATAGTAGAA
GAGGAGAAAGAAAGCCAGAGGAGAAATGGTTGTGCCCAGCCAAAGAGCATGGAATCACCA
AGAGGCGACAATCTAGTGCAATTTGGGAAACAGCCACTAGATGGTGCATTTTAGAATGAA
AATTCCAATAGAACATCAGCATATTGTAAGTCTGTAAAATAAACTATTAAAAGTGCTGAT
GATTGTAATAGTAAGTGTTGTATTGTCATCTTTTAGTTTGTTTCTCAGCTTTAATGTGCT
TTTTAAATACATAAATAAAAAACAAAGCAGCTGCTTCCCATCGCAACAGCAAAAAGATCT
AATGGACAGCCGATCGCTTTCATTCCAAAATGGCGGAATCCAGGGCTGTTGCTGGGTGCT
GCTGTTGCAATGGAACGTTCTATTGAGTGTCACTTCTTGGTCATTCTAAGCTCTTTGGCC
CAGCTGAGCCTGGTTTCTCTCAAGGTTTTTTTCCTTCACTTTTATCAATTGGTAAAGTTT
TGTTCCTCGCCACTGGCGCCACTGGCTTGCTTGGTTTGGGACTTGTGTAGCTGCACATCG
ATGGATTCGCTCTTCAGTGTTTGGACTTTCAGCAGTGAAATTTAACTACACTGAACTGAA
CTAAACTAAACTTCAACTCTGGAAACTAGACTGACACAGTTTCAATTTACTAAAACGTCT
ATGTTAAGCTGGTTTGATACAATCTACATTGTAAAAGCGCTATAGAAATGAAAAGTAATT
GAATTGAATAGAAGAAAATCAGACAAAAAGGTAAATAACAAAATAAAAATGTATTTAAAA
ATCTTTTTTAAAGTCATAAAAATGAGTCAATGTGAAATAATTAGATCAATCATTTTGACA
AGTGTCATATGCCATAAGTACTCATATCTCATAGTCATGACCTCACATTTGATTTTTGAT
TTCTTAGCAGTTTTACAATAAAGTATTACAATTTAAAAAGTTGAAATTATGAAAACTATA
TGACAAGAAACATTTGGCAAAGATGAAAACCAGTCATAAATATGAGGTAATCATGTAATT
ATTTGATCAATATTCTGTAATATTTTGGCTCCTTTTTTGTCTTTCTGTCTCATAATTATG
ACTTGTATATCTTATGTTTGACTATCTTTTTGCATGTCATAATTATAACTTGTTTAATAA
CATTTTTTATATCACAATCCTGACATTTAACTCATAATTATGTCTTATGTTTACCATGAC
TTCAGCTTATTGGTATGTCATGGTTTACATTCAGTCATAATCTGTAATTTTTTTTACTCT
TTGTAACAACTGTGTCTTTTTATCTCCTAGTTATGAATGATTCTGAATTACAGGTATGAA
ATCATTATAGTGTAAATAGACTTCCACACAAATCTATAAACCCTCAAAAGATCTGCAGAC
TGTAATGTTTCATTTCGTCCATAAACAAACATCCTTCATTCTTTGAGATGAAAATAAACA
GCAGCTCTACTTCTGCCATGCTCATTTTGAGCCCTCACCTGTACTTTTCCAGGGAAACTT
CATTTCCATCTATATCTGTGGCTGTGAATTCATAAATGGATTTGGCCGTCTGCCAGTCCT
CTAGCTGTGCAGACTGAGAACAGAAACACCACAACATAATAGGATAAACAAAAACACTTT
TCATCACAAACATTACACAAAAACATGCTAACTAAAAACCTGCTAATGCTATATTCACAT
TTAACCAAAGAACATATCTTATCATAGCTAACATGCTAATTCCTGCTACACTGAAAAGCA
AAACAATCCTGGTAGCCTAATTTTTTTTAGGTAACCTAATTAACCTTATGAGTCACATTA
ACTTGAATTACATTAAATCTGACTTAAACGGCTTGTATATCAAACAAAAAGGTTATAATT
TACATAAAAACACACGTGGTCATGACTTACTGATCATATCAGCATGGGAACATACTAATT
CATGCTATAAACATGTTAGAAACATGCCAATTATTGCTAAAAACATGCGAATATATGCTA
GACAACGAAGTCCAATGTGCTAGCCTTGCTAGAAACATGCTAATTGAGTATGGTAATTTA
CTAGAAACATGCTATCAACAAACTTTACTTAACTAGTTCTAACTTACATTACATTAAACT
AACATGAAAGGTTTGTGTGACTTCAAAAATGTAAGTTGAACCATGGTTAACTTATTTTAG
CAAACTAAATTAACATTAAGAACATTAGCTGTCATGACTAATCATTTGTTTACAGAGTGC
TAATCCAGCGTGTGTGTTCAAGTAATGAGAATATCTCACCATAGTCTGCAACACTAGAGA
GAAAACGACAGCAGACCCTAAGAAACGCATGACTGCCTTTCAGTATTTACTACTGAAACA
GCAGACAGCGAATTACATTAAATCCTCAATGTCCCTGAACTCCCACAACACTGCACACTC
CTCATATATATAATGCTTGAAGTAAACATTAACTTGACCCAGAGGCGGTTTTATTCCCTA
TAGGTTGAAGTTCTGCCGACTAAAGGGCTATGTGTTGAGTGTTTGACTGTAAACTGTGAT
GATAATGGGAGGATTTGAGAGTAAAGGTCAGTGGATGACGATCTTGCACAACTGAAAGAG
CTGATAGCTTGATATGATGCCATTCGCTTTGCATATTAGATAAGCTGTGGTGTGTGTTTG
GTAATGCTACAATGGCAAACACTGGATCTGTTTGACTTGGATACTGGCTTCAGGGAGGGA
TTCGTGCCACAAGGATATTATGAAATGGAAAAAGTGGGATATTGATTAATTTAAAAAGAC
TGACTTTAAAATTTGACATTAATTGTAACATTAGTTATGAATATATTAAAACTGTGAAAC
TATGACATTATGTCGTAAGTCAGGACATTGAGTCTTAATCATGAGGTTGATGTTATGAGA
TACTGTCATATTTCTAAAATTTTAAGTGATAAATTTGACTCATAGTTTGGCATTTTGGCA
CAATTATTGTGACATTATTATTGTGAAAATATTGTGACTATTAGTATGCATGTATAATAT
GTAGTGTTTTTAGTATGTAGTATGTTTTCTGTCACAGTTGAATGTCAAAATTTTGACTAA
TAATAATGATCGTTATCATATAAACTCATTTGTATCTTTTGTAATAAAAATGTATTGCTT
TTTCGTCATAATTTGAATTTTTAATGTATGTTACTCACAATTATGACTTGTTATATCACC
ATTTTCACTTAAGTCATATATGTTTTGTTTTAGATCAAAACTGTTAATTATTGTCACTAT
TACCTCTTATACATCTTTGTTATATCTTTAACCTAAAATTTTCACAATTATGACCTGGTA
TTTCACTGTTTTGACTCATTTCATATTTGTGTCTTTTTAATATAACAACTCAACTTTATA
TTTTTGTCTTTTTTTGTCATAATTGTGTCTTTGGCATTTGGTCATTGCATTTTGGAAACA
AACCTAGATTATATAATGTTTTTGTTAGAACTAGAAGTATGTGTTTAATTGTCTTTTAAA
TACCAAAATACAAATTTTTACAATTCCTTTTTATGGTGCTTTAAATAAAATAATGTATGT
TAATCAAATATATTTCAAATAGAAAAAAACATCATCTATTAGGAAGCAGATTTTTGGAAC
CTGTTTTTTTTTAATAATGCAGCCTAGATAATTCGTTAATTTATTCATTAATTAATTAGA
CAAAACAACTATTATTATGGAATTATTATTTTACTATTGTTGTTGTTGCGCTTGCGCATT
GTTTATATAACGGAAAAAGGTAACAGCTCTGACACAACACAACGACCGATGACCTAAATA
CACCAAGACCTCTCATCTTGAGCAACGACTGATTGTGTAAACAAACCGATGATAAAACAT
TTTCAAAACCCCCGTAATTACGCAGCAAATAACCCCATAACGCTATCCACCATTACGTAA
TATTCTACATTTGCAAGATCAGTAGTGTTTAACTTTACAATACCGTTGCACCAATGATCC
CACTGCTCGATAAAGCCCCGAACAGCAAAAAACGGTGGATGAACCCCATTTTCTGCATTT
TCCCCTTGCAAAGTTCAGTCAGTTGTGGTGTCGCACTCACAGAGAATCGTTCTTTTGAGT
CGATTCTTTTCAATAAATCAGATGAACCGCTTCGCCAAACAATTCATTTTAAAGTGATTC
TAGAGTAAACTTTAACTCGACTTCAGATAGAAATAGCTGCCTGTTTTTTTTATTGTTTTT
AGCTAAGGCATACTAATATGATAATGTAACCCACTCAAATTTTTGAGTGTTAAATATTGT
TTTATTTTGACATGTAATTAAGAGTTTCTTAATTAATTTTTTTTATTTGTCAGAATATAT
GTATTTATGTTTTATTTTCTTACCTTACCTAATGCACAACAATTGGGCATTTAAAAAAAA
TTTATAGATGTATAAATTTACATTCAGAAGTTAATTTCTAAAAACCGGAATTGAGGTCAA
GGGTGACTGACGTCACTTGTACGCCAGCTTGTGGTG
Chart Advanced