SelenoDB
Release 2.0
Chart Advanced
Sequence Report for SEQ00000511_2.0
Identity
SequenceGlutathione peroxidase 2 (GPx2)
SpeciesDanio rerio (Zebrafish)
DescriptionGenome -assembly-
Sequence IDSEQ00000511
Sequence release2.0
External IDNone
Gene SPG00000512_2.0
Annotation
Prediction method(s) None
OrientationReverse
Toolbox Forward Reverse  
Sequence
>SEQ00000511_2.0 # Sequence # Glutathione peroxidase 2 (GPx2) # Zebrafish 
TGGCCAGTCTTGACCCACATTTAAAATACACTAAAATCATTTTTGAGTAAAGAAAAAAAA
TTCTACCAATCAGGTCACTTTGAGAAAAAGCGTGCCCATAGTGTGCCTAAAGCGCATCAC
TCCATGGATTTATCAATTTAATTGCAATCGTGACACACCAACCTATCTGGCCCAGTTCAG
GCCCAGTTATGAGTTATTAACTTGGCTGAGACTCGGCCCAGATATGGTCCGTGTTTGGCC
CTTGTCTGGAAGCCAGATTTGGTCCAGTCATGTACCGTAATTCACTGCGGCATGTGGGCC
AAGCAAAACCTGAATGTGTGGGCCACAGTTGGGCCAGAGAAATTTTGCTATGTGGGTCGT
GTAATGTTTTCAAAAAATGATTATCCAAAGCTACAGAAAGGATACCAACACACAACAGTG
AAATGCTGCCATTGTTATATCATCAGTTCTACAGTATGTTCTTATCTTGCTGACAATTCT
TCTTTGGCAGAGCTAAAAACTTACCTTGGCAAGGGAAGATTTGATTCTTGTTATTCTTCC
CACCCGAGTCTCAACACATATAGCAGGGTTCATTTGAGTTGAATTTGGGTTTGATTATAC
TTTTTATATACACATTCATTTACTCTTTGCCAAGTACTTTTCTTTTTTTAACATGCAAAC
ACGAGTTTTGATCATTTTCCTATTTAAAGATTGACTCTTTTTGTAGTTATGTGTACGAAA
ACTTGAGCAAAGGAGGTCAAGGTGCTCCAGAATTGGCCTGCCCAGTCACCAGAGATTAGC
ATTATTGAGCATGTCTTGGGTAAGATGAAGGAAGAGGCATTGAAGATGAATCCAAAGATT
CTTGATGAACTCTGGGAGTCCTGCAAGAAGGCTTTCTTTGCCATTCCAGATGACTTTATT
AATAAGTGATTTGAGTCATTGCAGAGATGTATAAATGCAGTCCTCTTAGCTCATGGGAGT
CACACACAATATTAAATCTTTTTCCACTGCACCATGATTTTTTATTCTATACCAGGCCTG
TAGCCAGGGGGGGTTTCGGGTGGTTCGGAAGACCGCTAACTGACAAACGTCCAGAATTTG
TCCCATACATGAGCTCATTTTGTCTTATTTTGACTGCTGTGCCAACATAAAAAGTAAAAA
TAACCCATCGAAGAAGACTTTAAGACTAAGCGGAATCCTGATGTGAAGTGTCCAACATCC
AGCTGTGCAAGAAAACATCGGACATAAGCGAAGTCATCTTTCTTTACTGTATTGTTTTTA
AATAGGGAAAACATTTGACAAGTAACTTTTATTCTAAATCCTGGACCTTATTCTTTAAAA
AGACATGACCAATAAAAAAGTGTGAAGCACCAGAAGCGGCCCATATTAAAATCAATTTAA
ATACTCCTTTGGCTATTGTTATTATCCATGAATTTTCAAATGTACTTTTTTTGTTTACAA
GAGAGGCTAGAACAAATGTGAAACTCTAAATTATTACTATAATGTTTTCTTTTTTTATTA
TTTAAATGGCCAAATTCTGACTGAGGAAAGTTGAATGTGCTGGCCAGGTTGTTATTTGCC
TAATAAATTGCAATAAGCTACAGTTTTTAATTTAAAACTTTTTTTCTAATGATATATGAT
ATAATAAATTTTAAGAGGAGGAGAAGCACTTTAGCAACGAGACCAACAGCTTGTAAGTAC
ATTTAGACTTGTTTTCAGTTGTTGTGTATGGTTTGAGGACACTTAGACTTGTTTGCAGTT
TGTGTAAGGTTGTAGGACATTTAAACTTGTTTTCAGCTCTGTGTATGGTACTAGAAAAGT
TTACCCACTGTTTCCTTGGTTACTATAAGAGCTTGTGTGTTGAGCGTGGACGGTTTCGCG
TCCCCCGCCGCAGTTTCGGGTGTAAAGACTATATATTGAGCACGCTAGGTTTAGTTAGCA
AGAGAAGCACTTTAGCAATGAGACCAACAGAATAGCAGTCTCTTCAGATGCTTCAGAACG
CAGCAGCATGAGTGGTCTTTAAAAGAGCACATGTCACTCCGCTGCTCATCCGTTTGCACT
GGCTGCCAGTTGCTGCTCGCATCAAATTCCAAGCTCTGATGTTTGCCTACAAAGCGACTT
CTGGCTTTGCTCCTTATCTGCTCTCACTGCTGCAGATTTATGTGCCCTCCAGAAACTTGC
GTTCTGTGAATGAACATCGCTTCATGGTTCCATCCCAAAGAGGGAAGAAATCATTTTCTT
GAACTCTCGCGTTCAATCTGCCCAGTTGGTGGAATGAACTCCCGAACTGCATCAGAACGG
CAGAGTCACTCGCTGTCTTCAAGAAACGACTAAAAACTCAACTATTTAGTCTCCACTTCC
CTTCCTAATCTGCAATTGCCTCTCTGGCGATACCACTAACTGTACTCAAAAAAGAAAAAA
AATTCTAATGCTTTCCTTCTTAGGGCCCTATCATACACCCGGCGCAGTGTGGCGCAAGGC
GTGGCGCAGTAGTCTTTTGGTAGTTTCAGCTTGGCGCAAGAGTGGTTTTGAGGCGTTGCG
CTACGCTCTTTAAATAGCAAATGCATTAGCGCTCATTTGTGCGGCCATAGGCGTTCTGGT
CTAAAAAGGAAGGTGTTCTGAGGCGGACCGCTGGCGCGTTGCTATTTTGAGAAACTATAA
TAGATTTTTCATTAGACCAAAACTAACCCGGTCTAAACTCCAGCGCAGAGTTGCGCCTCG
CTTACGCACTGCTTAATACACACAAGAGAGCAATAGGCAAATATCTTTACATATGAAAAA
ATGTAAATATTAAGGATATATAAAGGATATAATAAGAATAGATATAGGATATAAATATAA
AGGATTAAAATATTACAAAACATATTATTTTCTAGCCTACATAAATATGAAAAATCACTG
CTTTTATGTCTTCTTCATCTCGGGAGGCTTTTTCAGTTCATTCATAACAATTTGCTTTTG
TATAATGTTATTATTATTAGCAGTATTATTTAATATATCCATATTTATATTTGTTTTATT
AAAAACAAGCTTAGATTTGCCCACCTATCAGGTTTTAGACCATATGGGGCACAGCATGTG
TTTTAGGATATAACTCAGGTTTTTGAGCACATTTTGTTATTATTATTCATTTATTCGTTT
GCTGGAAATTAGAACTGAATTTAGAAATAGTTTTGAAACGAATATTTGCGCTTAACAAAC
AAAAGTATTTATTTATAGACTAATTGATGTCTGTGCGTAAAGGTTTCCCTATCCAAGAGT
GAAAGTGAAAGTAGATCCATTATCTCTCATTCTCAAGCAGTAGATGCTCTGTTTAACAGT
TTTCTGTTAAAAACTGTGACCTGTTAACTGTTTGCTTGTGAAATGCTCATTTTTTCCACT
TAGACTTACTTTGCGTCCTGTAAATAGCGAATGCGCTCTTGGCGCGCCACAGCTGACTCT
TAAAGGGAATGGGAGATGAGACTCTAATTGGTTTATTCTCAAAACACACCTATAACTCAT
TAAGAAAATAAACTCAACCCTTTTAGACCATGCGCCACGGAGCAAGGCAGATTTCCCGTC
CTTAAATTAGCAAAAACGCGTCCTGACACGCCCTGAAAGCGTTTGCGCTCTGCGCATGGA
CCGTCAAAATAGAGCCCTTAGACTTTACACACCTGAAACTTGCCTGCAGCACTTATTCAT
TGTTGCTCTTATAGTTGTGTAAATTGCTTCCTTGTCCTCATTTGTAAGTCACTTTGGATA
AAAGTGTCTGCTAAATGACTAAATGTCTAAATGTAAATAAATTTGTATTTTAAAAATAAA
TATTTGTTATGTTCCTCTAAAATATTTAGGAAATATTTTGGTACTTCAAAAAGTGTGGTT
ATAATGACCATCTGACAAGATAATTCTGCCAAAATATCAACACAATCTCACGGCAATTCT
TAACTTTTTGATTTAGTGGCTAATTCGTATGAATTCGTACGATCTAATTCGTACAATTTA
GTACGATTTGCTTGTCCCCCAATGACGGTTGGGGTTAGGGGTGGGGTCAGGTGCCACGCC
TCCTTTTTAAAATCGTACCATTTCGTACGACTGAACTCGTACGAATTCGTACGAATTAGC
CACTAAACTGGCAAAACGTAAAATACTTACGTTTTCTCGTGAGATCAGGCTGTAATATGA
CATTCTTGCCAGATTTTGATTATGTTAAAAATTGTTAACGTAACGTAATTGGTTTGAATA
CGGTAACCTCGGCCCATCTTGAAATCAGGCGGCCGTCGCATATTGGTCCAAATGCTTAAC
ATTTATTATTATTACTATTATTATTATTATTATTATTATCATCATCATCATAATATCACA
TCTAGCAAGAGATAAAAGCTGCCTCCACGTAAAAACAATACATTAAAAAAAAAAAAAAAC
TGACCGGCCCACATTTAAAAATTGGTCCGGCCCTTCTGGCATTTGCCAGAATTGCCAGAT
GGCCAGTCCGCCCCTGGAGCCTGATAAAAATGCTCCTTTTAGAGGAAATTTTCAGACGGC
ATATAGAGGTTTTTGCATCTGAACTCTTCAAATACAGTCAAGCACACCTGTTCACAATCA
AGAAATCACTTAAATAGGACCTGCCTGACAAAGTGAAGTAAACCAATAGATCCTCGAAAG
CTTCAAGAGCAACTAAGAATAAAAAATAATGGAGATCTATCAGTCTGGAAAAGGTTATAA
AGCCATTTATAAAGCTTTGGGACTTCAGCGAACACATGCAGATGTTACATTAATGAAATG
TACAGTAGATGAGACAGATGACGCTTTTTATTTCAGTAAGTTTTTCTATTACATGATGAT
TGTTTATGGCATCATCCCAAATTCTTAAATATATACAGTCTCAGGTGCAACCCCGTTACA
TTTAGGTGCGTCACTTTCATTAAGTAATAAAAAAGAAAGTGAGATGATGCCGTAGAGCTG
CTAACAAGGAATATAATATAGCCTATATAATAAAAACCATTGTCAATGTGATCATTGCCT
ACATGTTTCCATTAGTTCTTGGTCAGCTTCAGTAGCCTTTGAATGTCAGGTTCAATATTG
ATCGTTTGAAACTTCTTACTGTATCTTTTGAAGGGCTCGCCTTCTGGCCCAATTAAAAAC
TTTTCAAAATTCCACGAAATATCATTTCGACTGACTGGATTCCAGACTAGATATTTAGGG
TCTTGAATTAAAGTCACAGGGTCATCGTCTGGATAAGGGAGCTTGTCTTTTAAGTAGGAA
AAGACAGGATGCGCATCACTCCCGTTTACAACGCACTTCTGAAAAATAGTGAACGAAGGC
TTATACCCTTCACCTGGACGAACATACTTTAAGGAATTAAGAATTTCTCCATCAGAGCAG
TTCTCCTGGAAAACAACAAGAACAAAGTAGAGAACATTAAATATTATATTTAAAAATATA
AAGCCCTATACACTAACACCGAAAATGTGACCCTGGACCACAAATCCAGTCCTTGCAACA
GCAGAAATACATTGTGAGGGTCAAAATGTCTCATTTTTATTATAATCCAAAAATCATTAG
AGTTTTAAATAGATTGTTCACCCCAAAATTAAAAATGACTCGCTATTTACTCATCCTTGA
GTGGTTCCAAACCTTTATGAGTTTCAATATTCTGAAACTTTTGACTTCCATATTAGGAAA
AGCAAATACCATGAAACTCAAAGGTTCCAACACTTTCCAAAATATCTTCTTTTGTGTTTG
ACAAAACCCTTAAACTCAAACTGGTTTGAAACAAGTCATGTTGTCATGAGTAAATGATGA
CAGAGTAAATTTTTTTCAATGAACTATTCCTTTAAGTAAATATTGTTCCATGATTATACC
TTGTACATTTCTTACTGTAAATCAAATATTAAAACATAAATTCTTTGAGTAGTCATATGC
ATTGCTAAGTATTTAACATTGATTTTGACATGAAAGTTCCTAACTGTCGCTATCCCATAC
TTATTTTTTATTTTTTTTTGCAGCGGATGGCCTTCCAGTCTTAAACCGGTACTTATCTTA
AAAAATAATAAAAAAATATGAATATATCATCTATAACTTTTAAGTGTGAAAGACTTTCAA
ATAACAGATTTTGAAATAGTTGGATCTCAGCCAAATATTACGGCAGTCAACCTTTGATGT
GAAACAAAGATCCTGTCCTAAGAAAGAATGGTTGTACAATAGTTATCCATAGTTATAGGA
CAGCTTTGATGAAGCAAAGCAAAGCACATTACAGTCTGCAGCAAACAATTTTTACAGTGT
GCTTTTAATATTGTTCAGTCTCGTCTTAAGGATCTTAAATTGGTTATAAATGTAGACAAA
TCTAAATTAACGATTTTCACAAATTCTGCACAAACTCCTGTGTTAAGCTTGGGTTTTCTA
TTGAAATGCATCCTGCTATTCTCTTAAAGGTCGTAAACATTTGGTGTCTGCATCATTTTT
ACCATTTATGGACTATGGACATGTTTTATATATGAATGCTTCAACCAAATGTCTTCAGCC
TTTAAACTCCGTCAATCCCAGCACTCTGAGGTTTGTTACAGGCTGTCAGAGACTTACTCA
CCATTGTCAATTTTAGGCCAAAGCTGAGTGGTTTTCTCTGTATGTAAGAAGGTACACTCA
CTGGATGACTCTGGTCTATAAAGCTCTTCCGGGACTGGTGCCTTTATACCCAAGTTCCCT
TCTTCATAAGTCAAAAAGCCAGTATGCCCTATACGTTCAAGTGAATCTTATCATTTGACT
GTTCCCTGGGTTCGGACTGAAATAGTGAAACAAGCCTTTAGTCATGCAACCCCCTCGTCC
TTGAATACTCTTCAGTCTAAACTCAAAACAAAACTCTAAACTCAGAACAACTAATCTGTA
TTTTTATATAATAATATTTATAATATTTATAAATAAATATATATATATATGTATAAATAA
ATAAATAAATACATATATATATATATATATATGCAAAGAGTTTTAATGAAAAAGACTCTA
AATGTCATCTCAAATTTTCTTGTTCAGGAACACTTCCCAAAAGACATTATTTGAACGGCA
TCTACACTTATGTTAGTCTGTTTTTCAAAATCCCGAGGTGTCCATAATCCTAGACCAGGC
CGCATCCTGAGCAGATGCTATGGCGGTCGTTGAGAGCATGAGACTGAATGACAGACGAGT
CTCCGCATTGATCCCGTGGGCCAGCCTGAACACCCACCGGTGACCTACTCCCACCTACAG
CTTCTCCACGATGGATGTCCAGAGTTTTCCAGCCTCCAGCACCTAGACTGCAGCTCTGCA
CAGGAAGTTTGGCCAGAGGAGAGATGGTCGTGCCCAACTGAAGCACTGGCTTGCTTGGTA
TGGGACTGCGCATCGCTGGATTTGCTCTAAAGTGTTTGGACTTTCAGCCATGAAAATTAA
ACCACTCTGAACTGAACTTCAACTCTGAAGACTGGACTGACAGTTTCAATTTACTTAATA
ACTTCTATCTTAAGCTGCTTTGACACAACCTACATTGTAAAAGCACTATAGAAACAAAGA
TGAATTGAATTGAATTCTGACATGAGCATTTTCCTTAGGGTCCTATGTATGGGTTCAGTA
AGTCCACTTTTATGGCAACAAATTGGTTCTTTTTATTGCATTTAAAGTAAAACAACTGCA
CATAAACATAGGAGGCAGAGAAAAATGCTCATTTCAGATGACACTTAGAGATTTCCATTT
TAACTCTTTATATTTATTCAGCTTTCAGATGCCTAAATCTCAATTTCCAAATAACTGATT
GGGTTATTGGTCCAGAGTCACAAAAAGTGGGTAAAAATTCCTAATTTACAAACCTGGTAT
CCAAACTGGTTGCAGGGAAAGCCCAGGACTACAAGCCGATGAGGATATCTGCTCTGGAGC
TCATTAAGCTGCGTGTAGTCCTGGGTGGTCGTCCCTCACAGCGAGGCCACATTCTCAATT
AGCACCACTCTTCCCCGGTAAATATTAAAGTCTATGGTGTCCCCTTCCAGAGTAGTTGCG
TGCAGATCATAAAAAGTCTTCGCTATGAACGTCATGGTTCAGTCTCGCTGTCCTCATCAC
AATGACAGTCAGCGTTTTTTTCCCCCTACTATACTGTTGAGAACGCAAGTCACATGACGT
CATTTATAATGCAAGTCAGACATCTTAGATAGCTGATACTTCAACTTGTTAAACCGAGAG
CAGTCTGAAAGACAATGAAGCAAACTTTTTACTTATTGCATGAACTGTCTGATACAGACT
GTATAATACAAAGAATTTCTAAGAAAAAAAAAGATATATAAAAACTAACTACACTATTGA
GCACCATGGAAATTGTAGAAAGCGTATCAGTTTCAAGGCCATGTTTTATTAAGCATACTT
CTGTCTCCATTACCTTGAATGTTATAAAAAATGGATGATTGCAAGGGTAATAATCTTCAG
AGCTCATGTGCTAAATCACTCATTTGTTAATACAGAAAAGCTTTCATTCTTTAATTTCTT
TCGTGTAGAAAAATTACAGCATTACCACTCACAGTATTTATAATTTAAGGCTGATATTTT
AGCTTTTTGTAATGGTGTATGACTGTATTATTCAATTGTCTTAATTGCAGTTTTTAAATG
AAGTGGAAATCGACGTTCAACCCTGCTGAAAAATCCAGCTTAAACCAGCCTAGGCTGGTT
GGCTGGTTTAAGCTGGACTACCAGGCTGGTTCTAGAGGGGTTTTGGCCACTTCCAGGCTG
GTTTCCAGCCATTTCCAGCCTGGTCTTAGCTGGTCAGGTTGGGAGATGACCAGCTAAAAC
CAGCTTGACCAGCCTAGCCAAGCTGGGAGTCCAGCCAAAACCAGCTATATCCAGCTTAAA
CCAGGCTGGCTGGTCAAGCTGGTTTTAGCTGGATTTGGCTGGTCATTTTCCAGCTAAGAC
CAGGCTGGAAACTAGCCTGGAAATGGCCAAAACCCCTCTAAAACCAGGCTGGTCAACCAG
CTAAAACCAGCCAACCAGCCTAGGCTGGTTTAAGCTAGATTTTTCAGCAGGGTCTGAGGA
AAAATCACATGAAAAATCTTTTACATGCAAAATCTATTACATTTTCTAGCTGGAAAGCAC
AGACTGTTTCTCAATATGCGTTCTTCCCTTTCTAAATGCTACCTCCTGTGACCAGTCTAC
CCTGAAAATTGTGATGTTGGTGTATGGTCGTATGGCATAATCCACGTTCATCTCGATTTG
ATTGCTGTGTTGCTGTGCTTGAAGTTTTCTTCACTTTTGATTCTCTCTGTTCTAGATAGT
CTTGAATCAGACCAGTTCGAATGTACACACTCTATGTTTTTTGGGAAGTTGAATTTGGAT
AACCAAGTTAGATCCGTCTGACAACTTGTTGTTTGTGTCTTTGGTGTGACTACAGCAGAA
TTCGACTTATTCAGTTCAAAGGCAGGGAATTCTTCAACTATTTTACCAGCTTCAAGATAA
CTCATCTTCCTTGTATGTTTAATTTTTTTTATTTTTTTCTCCTTTTTTTTTGTATATATA
TATTTTTTTTGTATTTTTGTCTTGTAAGGCTTGAAGCTTACGCTGCTATTCTGAACCAAT
AATCGGAAACAGGAAGCAGTTGAAGGATGGCGTGTTTAAATCCATTATTTATCTGACTCC
ATTGTAATTAATCTGACTCCATTAAAGTTGTTATCATCATTGATAAAGAGAAAGAATCTC
TACGTCTTAAAGCAGGCAAAGTTGTTTATTAAGTTACATGTTTAAATATACAAACATTAG
AATGAAACAAACTAACATACTGTATAAAGAAATTAGCTGTAACGTATGCACTGCTGAGCA
ACTAAGACAGTGAAACTGCCTTTGTTAGCATATGAGGCTACGCACCAGTGTGCGGGAGAT
GCAGAGTAAAAGCCATTCTCCCCGATCAACAGTTACCTTTCCCTATTATACCCTGAGCAA
AGCATTGTCAAACATAAGTGAAAACCAACCCCCAAAACCAGCTGAACGTGAGAACAAAGT
TGAAGAGATGAAGTGGGGGAGAAGTACATTAACATACTCTCCTCAGGCCATGACCCAACA
ATAGTAAATATATTGTAGATTGAAACACAATTAATCGATGTCTCTGTTGATTTCATCACT
ACAACACTGAAGTCATAAACTGTCAAATGACACCAAACATGACAAAGTTATCTGAAAGAA
GAACACGAGCAGATGAATTGTGTATGGTGAAGAGCACATGGTTACTGTAAGCAAATGGCA
GAGATGTGTATCGGAGCTGTGAGGAACTCTGCCTCACCAGGAGGACCCATCCCATGCTTG
GAATGTCTCAGTAGTCCTTCATTAGCATAGAAGGAAATATATATCATATTTTCTCAGCTT
ACAGTCTAGATGGGACAATTTTTTGATGAAGCTGCATGATCTCCAAGGCAGTTTTTACAT
TTAGAGCGTATTGTGCCGTTCATTTCATGCAGCTGGGACGCAAACCAGCGAACTTCGTGC
TGTGAAGCAATTATGCGGCGCCCCATAGATAAATACACAAGATATCACATACGAACCCCG
AGCATGCATCAGTACTGTCGCCATATTTGTACAGTGCTCCCAGGACAAATATCATTCAGC
CGCACTAGTCAAGACCAAAACCATTATGAGGATGCATTTTGTTGTGTCCCTAGCTGCTTG
CACTCTCGGCAGACGCACTTTTTTCATTCATTTATTTATTTGACCATAACCTCACTCTTT
TTATTCATTGTTTTGCCACAGCTCCGCTCTTTTAAAATGTATTTTCTCGCAGCCCTGTGA
GCAAAACGCAGCCTGCAGGTTATTGATGACGTAGCAGTCGACCACAAACAGCAGCACTTT
AGTAAATATAAGAATTTGAATAAAAATATAAATAATATTTCACCTGCTCAATGAAAATCA
GATGATTCACGTTGATAAATCTGACATGAACACAATTGACATGACGTAAACCATCAATTA
AATGTATAGTGTCATTTTGGTTGAGTGGTCAGCATGTTGCATTATGACGCCACAGACCCG
AGTTCGAACCTCACCTCAGTAATTCCCCCCCCCCTCATTTTTAGTGTTAAGACATATAAT
ACTGTTTGGCTTACTTATGTAGGTGTATACATTTTAATTTTAGTGTGACCACGGTAACAA
AGGACTGGATATCTATAAAGAATTTTGCACAGAATATATATTCAGATATTGCAGGAAAGG
ACATTGTGATGTTTTAAAGCAGGGGTCACTAATCTCGGTCCTGAGGGCCGGTGTCCTTCA
GATTTTAGCTCCAACCCTAATCAAACACACCTGCAAGCTAATCAAGCTCTCACTGGGTAT
ACTTGAAACATCCAGGCAGGTGTGTTAAGGCAAGTTGGAGCTAAACCCTGCAGGAACACC
GGCCCTTCAGGACCAGGATTGGTGACCCCTGTTTTAAAGAACAGTGTTGGAAAATTAGCA
ACTACAAAATTTATGAAAAACATTTGAAGTTCTAAAGCAGCTGTTTTCTTGAAAAAGACG
TGATCGTATAATTAGAAACTGAATTGGAAATGACGTTATTTTAATTTAGTCAGTCATGAC
CTGAGGTGGGCCGGTCTAAGGCTTGAAACTCCAGGTCTGACAACAAGTAACATTATTGAT
GATTACAGTCACTTACTGCGTTAGCCAAAAGGCAAAGCAGCACCAACTTGCACTAAATTC
CTGGCTTATGTTAGCATTGGCAGTGGCGCAGTAGGTAGTGCTGTCGCCTCACAGCAAGAA
GGTCGCTGGTTCGAACCTCAGCTCAATTGACGTTTCTGTGTGGAGTTTGCATGTTCTCCC
TGCCTCCGAGTGGGTTTCCTCCAGGTGCTCCGGTTTCCACCACAGTCCCCACAGGTGAAT
TGGGTAGGCTAAATTGTCCGTAGTGTATAAGTGTGTGTGTGTGAATGTGTGTGTGTGGAT
GTTTCCCAGAGATGGGTTGCGTCTGGAAGGGCATCCACTGCGTAAAAACTTGCTGGATAA
GTTGGCGGTTCATTCCGCTGTTGCGACCCCGGATTAATAAAGGGACTAAGCCGACAAGAA
AATGAACGAATGAGTGAATGAATCTACACATGCCCGTCCAGAATTTGTCCTTTTAATTAT
TTTATGTAATTTAACATTATATAATATTTTTTATATAATTAATATAACATATTAATATTT
AATATATATTGTAATAAAGAGTCATTTTAAATAACTCTGGCCAGTAATTCGAATCCCATT
GACAGTAGTAAAAGTCTTCTTTCACTACTGTTTTGTTTTTAAACAGAGAACGCAAAACAT
TTTACAGGTAACTTTATTCTAAACCTTTGACCTTATTTCCGAATTAAAAATGTGCAATGT
AAAGGTGTGAAGCACCAGAAGCGACCAAATTAAATTAATTTGAATATTGTTTGGCTGTTG
TTGATATCCAGGAATTTTCAAATGTACTTTTTTTTTTACCAAAGAGGCTAGAAAAATTCT
GAAGAATTCATGATTATTGTTTTAATATTATTATATTATTTTTATTAATTCATTTTTTTT
GAATGAACCGCTTATTATTATTGTTGTTATTATTATTATTATTATTATGTTTTAATTATT
ATTTTTTATTAAAATGGCCAAATTGTGACTGAGGAGAGTTGAATATGCTGGCCAGTTTGT
TTTTTGTTTAATAAATGACAGTAGGCTGCATTTTTTTTTCCTAATGATATATGATCTAAT
AAATTTGTATTTTAAAAATTAGACTTGTTTTAATTTCTTTATTGCACATTTACAGTACAT
CAAAAAGTGTGGTTATGATGACATCTGACTAGCTATTCCAGCAAAAAAAAGTACTGCTTA
AAATGTCACTAAAACGCAGTATTTAAATCTCAGGAAAAACCAGGCTGGCTATGGGCCTGC
TACATCATACGTCTTAATCTCAATTCCTGGAGGGCAGCAGCTCTACACAGTTTTGCTCCA
ACCCTAATCAAACACAGCTGATCCAAATAATCGAGATGTTCCAAAGAGTCATGAACACAC
CGTCTTTAGTTAGGAATTCCTAACAATCCTGTCTCAGAGGTCTACAGAAAACTCC
Chart Advanced