SelenoDB
Release 2.0
Chart Advanced
Sequence Report for SEQ00000474_2.0
Identity
SequenceIodothyronine deiodinase (DIO)
SpeciesCiona savignyi (Sea Squirt)
DescriptionGenome -assembly-
Sequence IDSEQ00000474
Sequence release2.0
External IDNone
Gene SPG00000475_2.0
Annotation
Prediction method(s) None
OrientationReverse
Toolbox Forward Reverse  
Sequence
>SEQ00000474_2.0 # Sequence # Iodothyronine deiodinase  (DIO) # Sea Squirt 
TATGAAAGAAGAGAAGCATCACAGGTATGTTTATGATGTCATAACTGATTCCTATGACTC
ATAGAGCAGATTTTATTTTTACGAATTTTTGCAGGAAATGGATAGAAGAAGAAGTTTATC
GAGGTAATTAAACAAAGTTTGTTTATTTCTATTTTCTTATTATTGTGTTTTTGGTGATAT
TTGGAAAACTTATATTAATACTTTGGTAAAATTGCTAGAACATTTTATTATTTAGAAATG
CTAAGCATGCATTGTCAGCTTAATGAAGCTTTTGGGCAATGTAATATGTGTTGAAGAAAT
TGTTATTTTTTTTTTAATAGAATTACTAAAAAGCATAAAGTTTGGATCCCATAACCTTAA
AAGACAATGTACGCTATCAAGCTTTATCGTCTGCGGTATAACTACCTAATAATCGAAAAC
ACAAACAAAAAAACATTCCAATAGTTCAACCTTTGTTTTTATTTTTATTTCTTTATTTGT
TTATTCGATACTCATACTTATCAATTGCCTTATATCGAACCGATTTATTTTTCTCAAAAT
TCTTTTTTTTTTTTCGCTTCAAAGTTTAAATTCCCTGGTTTCAGGTCACCTGACCGCCGT
TACCATGACAACCGATCACGTGGTTACTACGGCAACAACCAACGATACAACCAGAGGTAC
AGAGGACACAACCAATATAGAGGTGATTATGATGTCATAGATTGAATTGTATATGATGTC
ATAGATAAACGTTTGTCATTCCGCATAGTCTTGTGGTTAAGAACAGAAATCCCAACCGGA
TGGGTTCTGGGATCGTTTTTCGACATTCCCTTTTCTGCATAATTTTTTTAGGTATAATGG
ACGGTACAATTCGAATAAAATCTTTAAATGCTAAACTGTTAATAATAATAAATCACAATG
TAATATATCACGCATCCTTGACATTTTCCAAGTGTAAATCGGAAGATTGCATATTGTATA
GGACTTATTGCCCCATTCACAAGGTTACATAAAAACTAAAAGGTAAAGTATAAGAATGCA
TAGATTTCTATGTAACCAAGAGTTACAGATGGATACAAGGGTATTAAAGTATTTTTGTAA
TAATTATTATAGGTTCCCTTACAATACAAAGAAAAATGGACATTTTGATTTCACCTAATT
TTTTCCACAAATGTTAGCAGAATAAAAAACACTTTATTACCTTCTGCTAGAGCTGAGCGT
AATTGATCAAAGTTGTATTACGAAATAACGCCAGCTCAGTTACGTAATTCCGTAATTTTT
ATGACGTCATCGTTATTTAAACAAACAACCAAAAATTGCCGTGTTTTACAAAGGGCACTG
CATCTGCAGTACACAAAGTATTAACTTCCTATTCCCTTGCCAGGAAACTACCAAAACTAC
AACAATCGTGGCAACTATTACCACAATAACCGAGGTTATAACAGGGGTTACAACAATAAC
TATCGTGGAAGGGGGTACTACAATAATAACAACTACAATAGGTGAGAATATCTTGTGTGT
TTTGTGATGTGTTTGGTTGTTTGAAACTAGCCATTAGCTAAGTGTAAGTGTAAGTGTATT
CATAGGATAGGATATTCATGTTTATCCCCGTGAATGGAAAACCAAGGGGGTTAACACACG
GGCAATCGTCAGATCACCTTGCGCCAATTTTCGAGTTACTGGAGATATTGCAGTGTGTTG
TATGTGATAGACCCGTTCCTTCAATTTGGTAGAATCCATTAATCCGCTGGGTCCAGGCAA
TGTCCGTAAAGTGTCTTGCCCAAGGACACAACCGACTAGCTAGCGACCAGTTTAGAACCT
GCAACCTTTCGATTGAGAGGCTTTGTACTAAACCACCAGACTCACCGGTCGGACAATTTT
CATGCACAAATGTGGTTGGTTGAACCCAGTTGATTAATTTATGGGTCAAAACCTGTCGCA
ATGTAATATAAAATAACCCCTGCGGCGCAACAATTGACAAAAACTGCACTTAACTGTTCA
CTATTGATATTTGTAGAGACCAGCGCCCCCAGTGGAAGCCAAGACGCCACGAAGATGATG
ACCGTGGCACAAGGTCATTGTTCGTCAACAATAACGTCATAATGTATAATGTTATTGTCT
GGGGCCGTTTTCGAAACCACGATACCTCGTCAATAAGCCAGTTTTTTTTTAATTCGTTAA
ATGTACCGTTCACCATTAGGCTAATGACTGTTTTTTTGTTTTTTTTTTACCGAGTTAAGT
TCCGAACCCATGATGGGCTCGTCACCAGGACCTTTTTTATATATTAGAGTCGGTATATGT
ATCGGTTGCGTTAACCATTCAGCCATACGACCCTACAATATTGACTAGTTTACTCGCCAA
ATCTCGGTGGATTTTTATGCTGCTACCTAATGGCGGAAAATATGGACTTTTTTCTGATCA
TCAACTAGAATTATGTTTTATGATGGCTTAAGCATCGTCAGCTAATAGATTTATGGGAAA
TGGCATCACACATTATAGATCATTTTATGCATTGTTGTTTATAGTGTCATGCAATGTGGT
AGCTATCACCCGCTATTTCATTGTGACGTCATAGCCGACCATTGTCACAGGTCCCAAGAG
AGAAGTCGCTCAAGAAGTTCCAGCAGAGGGGAATCCCCTAAGAGAGCGTCATACGCGAAG
GAGATGCGAGATCACAGGGTCGTCCAGTCCTCCGCACCAGGTGAACTTTTGTAACCCCAT
GACCCCTTGTAACCCCCATGACCCCTTGTAACTCCCATGACCTGTTGTAACCCGTGTGAC
CTCGTGTAACGTCCAATGTCTCACGTCACCTCCATTAGTCCTATTACTACCTCTTGTAAC
AACCATGGGCAATTGTAACCTCACGACCTTATATTGTAACCTTGTAACCCCACATGACGT
TTTGTAATTAATTTTGTTTCGTTAGTGTATTAAAGCGGTAAAGAAAACACATTCTTAATA
ATTAATTTAACATCCCGATTACACTTCATTGTAAAACATATTCATACCGGAAATTTGATG
TGCCCCCGTTTAAAACACAACGCCCGTCGATTTTACAGATATAAAGATCAAATAAGGAAT
AAAATAGCAACTAAAAAAGCCTTTCTCGTATTTTCATCTAAATACGTAAAATACAATAAA
AAATTAATAAAATGCAATAAAAAATTAGGATTTCGGCTAATAATAATAAAAGAAACTGCG
GGACAACCTAATTCCCGGAGGTACAACCTTTGTAACCCATATGACCTCTTATAACCCCAT
ATGACGTAATGAAACCACGTCTGTTAACCAGTATGACCCAAAGAACTTTTACAAACCCAT
ACAACCCCCCCGTTTCAGCCTCAGAATCGCCCCGTCCAGCCGACGCACGTGACCAGATAG
AATCGGCGAAGAAATTCACAAAACTCCGTCGTAAATCTCCCGACCAATGGGCTCATGATA
TGTTTCAAGAGTCGGACAAAGATGACAAATAAAGGTGATTTCCCTAATTAACATAGCTAG
ATTTACATAACTGTCGATAGACCCATGATGTGAATTAACCAATTTCCTTCACAAGTTATC
CTACGATGCCTGTGGATAAAACTCATAACCAAAAGGTGAAAGGTTCGAAACTGGTCGCTA
GCTAGTTGGTTGTGTCCTTGGGCAAGACATTGCTTGAACGCAGCGGATTAATGGGTTCTA
CCAAATTGAAGGAATTAACGTGTCCATCATATACAACACACTGTAATAGCTCCGGTAACC
CGATGGTGGGCGCGAGTTTATCTGATGATTTCCTGTGTGTTAACCTCCTTGGTTTTCCCA
TCCACGGGAATAAAAACAAACATCCTGTGCTATACTATCCTAGATTTATCTAATTTAAAG
ATATGATTCAAAGATCTAATTTAAAGATATGATTTAAAGATCTAATTTAAAGATATGATT
CAAAGATCTAATTTAAAGATATGATTTAAAGATCTAATTTAAAGATATTTTTTTTCAGAC
CTTCAATGAAAATAATGTACATATCCGACAATTTTAGCACCCATCGAAATAAACAGATGT
GATTATCATTGTGTTTTTTATTGGTTATTTCGTCGAATGTTGCTTTGCGAAAAATCCGGA
AAAGTGGTTTTAGCTTTGTTAACATGAATAGGGAAACGCTTTATGGAGGGAAAGCGGGAA
GGAGGGAAACTGCTCACCAAAACTATTGAAATTAATTTTACCCCTTTACTAAACACTAAT
CTCAACCACAGAACTAACCCTTACTCCAACCCTATGTTTAAAACTAACTCTAATGCCTTA
ATCTTCATTTTATTGTGCAGTTTCCCTCCAAGTACTTTTCGCCGCATGAGTATTACCTAG
TTGTTTCTTTCATGGTTGCACTTAAGGCTAGTTAAGTCTGTTTGGAACTAAGCGGACGTC
GATAAAACCATTAGTTTTTGCTTTTTGGCGGGAAGTGTACTGATGGTTACCAGCTAGAAA
TTTTCAAACAATATTGGCAAGGTTTTTCAGTGTAGGTTGCAGATCCCAGCTTTAATTTTA
AAGTGTGAAAAAAATTTAAGACTTCCTATGTCAGGATTTTAAATGACAGACGTTTTTGTG
AGGTCAGTTTGCATTGGGGGAGATAGGGAAAATAATTGGTTAAATACCTAATTAATCCAT
TTAGATGAAAAGTCCAAAATTTTACATTTATTTCAGTTTATTACGAATAATGCAATTCCA
ATTGCTAGTTCACTATATATCAATCAGTAATTGACAGGTCCGAAATACATCAACTAATTT
GCTTCAAGTTTTCGCCACAAATTTCAACGATCACCTTCATAAGTTCAGTTGAAGTTTTAA
GGAACTGTTTAAACTACACGTAGAAATGCGAGTTTATATATACCCAATTGGATAACATGT
TATAAGAAATGTAGGCTACAAAGGATTTTTCAACTGGCACGATTTCGAACGGGATAAGAT
TAATTGAATTAAAATTGTACCAAATTGAAATCATGACGTGTAAAAAGTTTATATAAACTT
AAAAGGAATAAACGAACTTAAACTTTCTGCAAGCAGTTTTTCAGACTATCTTCCATTTCG
GAAAGATTGTATCCAAAAGAACCTCTGGCACCGTCATATTTAATCAAGTTGTCTTGCAAA
ATGTACAACCTCTCCGGGAGTGCTGCATACTGTACAGCTGCCTCGTCATTCATATTATCA
ACGACAACCGGGCATTTAACTTGTGCGTCGTCTGCGAAGATTCTAGCTGCTGAAATACGT
TCTTCCAAAGATTTGTGGTCGTAGATTTGGTATTTGTTGTTTGCAAAACTCCATCCGTTT
ATTGGATGCGCCTCGCGGATGTAAATTACAAGGAAATCGACTTCATTGGAATATTTTTCC
ATTAGCCGTTTGAACTCCTTTACCTGTAATAGAACATTCAATTAGAATTTCACAATATCT
CTACCTAAGTCCGACCTGTTAGTCTGGAGGTTTAGTAGGACGCCTTTCAACCAAAAGGTT
TCAGTTCTAAACTGGTCGCTAACAAGTCAATTGTGTCCTTGGGTTGGGCAAGGCACTTAA
CAAACATTTCCTGAACCCAGCGAATTAATGAGTTCTACCAAAATCATGTGAATCATAAAC
ATGAAATTGCAATAGCATAGGTAACCCGACGGTGGTCGCGAGGTGACCTAACGATTGCCC
GTGTGTTAACCCCCTTGGTTTCCCCATTCACTATATCCCTATCCTAATATTACATTTCTA
ATTTAGTTCTGTCCCTAGCTCATTGGTATCTTTTTGCATCTCCAGTTCAAGGGTTCTGGT
CGAGGCATTTAGAAAACGTTGCCAAACGATCATGTGGTCGAATGGTGAAGGCGACTGATT
CATATTTAGTAACCATTTAAAATCAGACCAATAGTGCAAACTTTTGATTAAAAGAACTCT
AAAACTGGGAATCTAACAACCTGTTGGATAGCAAATAAAGACTTCCTTGCAAAGAGATTA
AACAAACAAAAAGATAAACCAGGTCAAGCATATTTAATGACATATGATGCCTAAATATAT
GGAAAGCCCATTTAAACAAACCAATATAGATGGTAAGATACTTAAAAGTCTTTTCAAAGA
ATACTAATGTTATTAAAAATGGAATTATTGTAATGATACAAAATTAAAAGACATATCAAT
CATACGAAACACAATGAAATAGCTCCGGTAACCCGACGGTGCGAGCGAGGTGATCTCAGT
ATTGGTGTAGTAACAATTCTTGCGTTTTTTCATTTACGGGGATAAACATGAACATCCTAA
CTAGTCATTTTCACAAACCCTCGACCATAAATGGGGGTCACGAGCATGAGCCAAAGTTGA
TCACGAGTGGTCGGTTGCCTTTCACGAAATCCATGATTTTACATTCACGTGGGTCATCTT
CCAGCGAATAAAGCTTAACGTTCGGCACGGGTTTTCCAGTGACCGCTATTCGATGGAAAT
TTCGAATAAATCCGTCCACAATATGCCAGATGGCGGGCGTCTAGGGTTAAAATAAATGCT
ATTTGAATAAGGCGCGGCGTGGCTGAACGTTCGTGTGGTCGGATGGTTAATGCGACCGAT
GCATATACCGACTCTTATACAAAAAAACGATCCTAGTGACGAGCCCATCCTGGGTTCGAA
ACTTGGCTTGGTAAAAAAGTAGGGTATCGTGGTGTACGGTCGTGTGGGCAAATGGTTAAC
GCGGCCGATTCATATAGGCCTACCATGCAATTCCATAAATTAAAAACCGTCTGAGTGACG
ACCTCATCTTGGGATCGAAACTGAGGCAGGTAAAAAAATAAAAAAATAAGGCGGCGTGGC
AGAATGGTTAAAGCAACTGATACATATACCGATATGCAGAAATGGTTTAAGGACCAGCTT
ATCATTGGTCCCACCTTGGTCTTATGGGTTCGCACTTTGGCGGGAGGCAGAAAAAGAAGG
CGGATGTACTGTACGAACATGTGGCCGAATTGTTAACTCGGCCCATATATATATACTGGA
TTATATAAAAAAAACATTCATTTTTCAAGTGTATCTGGAATTCGGTACGTATCATTTATC
AAGGTCGTTCCTTAAACATCCCGGCTAAGAGAAGATATGCAGAAAAGGATAGGTTTGTCT
GACCAATCTTTAAAGATAAACTAAAACTGCAGTAAAGTTACATTGTCGTAATATTATTTG
CTAATACACAGTGAACACATTTCAATAATGACAAACATTGTCTAAACCCAGTGTATTAAT
GGGATAAATGTACAATATAACAGGCATAGATAATGTAACCTTAGAAGTAAATACCTGAAA
CACATTGATTTCCATCATAGATAGGAACTTGCTGTCCGGATAAAATTGCATCAGAAGTCG
TTTGAAGCCTGGAATCTGTCTTACCAGGGTAAAGAGGCCAAGAGAGAGATATATTACCAA
TCCCGCCGTAAAAGCTCGAATTTTTACAAGCATTTTAACAGGCCAGCCCATGCTTCAACC
TTTGTTTTTATGTCTGCAATGCAGGTGGAAAATTGAAACTGAAATGTTAATTCCATATAG
ATCGCTTTCAGTCGTCCGACGGGTTAGTCTGGTGGTTTAGTGCGTCGCCTTTGAGCCGAA
GGGTTGTAGGTACGAAACTAATCACTAGCTAGTCAGTTGTCTCCTTGGGCACTTAACGGA
CATTGCCTGAACCCTGCTTTTCTAGTAAAGTGAAAGAACGTGTGAATCATACACAACACA
CTGCAATAGCTCCGGTAACCCGACGATGGGCTTGAGGTGATCTGACGATTGCCCGTGTGT
TAACCCACTTGGTTTTCCCATTTACGGGGATAAACATGAATAACCCATCCTACAGCAGAA
TTCTTTAGTAAAAAAACGGGAATATTCTTTTAGTTTATTTATTTTTCCCTAGTATTAAAT
AAAGGCAAATAAAACAAATCACAACACAGGAACAGGCAAAACGAACAGAAGTTAAAACAC
ATTATTATATCAAAAATATAGCAGACGCAGCATCCAAACCTAAGCGTAGCCTACATTTAC
ATTAATTTGAAATATTTATTTGAGCGATCGATTAGCATAATCCTGCATAATCAACTTGGT
CAATGCACTAAGCCGTCTTGCCTGAACCCAATATAATAATAAATTCTTCTAAAACTGAGG
AAATGTCTCAATCTTATACAACATACTGCATTAGCCCTGGTAAACTGACAATTAGCCATA
TGATAACTAATTTACCTAACCTGGTCGCTAGCTAGTCTTGTGTCCTTGGCCAAGGCACTT
AACGGACATTGACTGAACCCAACGGATTATTGTGTTTAACTAAATTAACGCAGCGTGTGA
ATCAATACACAACACAGTGCAATAGCTTTGGTAACCAGACAATGGACGCGAGGTGATCTA
ACGATTGCCCGTGTGATAACCCACTTGGTTTTCCCATTCACGGGATAAACATGAATATCC
TATCCTATCCTATCCTAACCTATGAAGGGTTTGAACATGGCCTGTTAAATAAAATACTGT
TTTTCTATTCACGAAGATATCTGCCTGTTAGCACGTCTTAAAGAACATAGCTGTACTTCC
ATTTATATAAATTGACCAATCTTATATCTGACAATTTTCGGAATAAAAAGCGAAATAAAA
ATTGGTTATCCATTTTAACTAGCTGAACCTACAGGCTACTGTTATGGTTCTGATAATCGA
CAAATCCATGTCCGCATAAAAAAAACATACTGTAGTTATATTATTTTCAGTTACCGTTCC
GTGAAAAATAACTAAATAATATTTTTCTAAGATCTATGTTTTTGGGTTAATATTAAGCAA
TATGTTTTACATTTGAAGTAAATATACAAACTCGTCAAATCGTGCACGGTACAATCTAGC
AAAACTTAACAAAATCTTAAAATGATCAACGTTTCCTAGCAAGGCACGAAGTAAGTCAAG
TGCTCTTGTGTTTTCAGGTAACCTTGATCAAACACAGAATGTGTGTCAAAGTCTGCAGAC
CAAATGATCATTTGTTTACGAGCAAACTTCGGCAGCAAAGAGGAAATCCAACTGAGGGTC
CAAAGTTCGTTTTTGCAATGGACTTAAATGAAAGATCAGAAATTAGAATATTCATGATTA
TCCCGTGAATGGGAAAACCAAGTGGGTTAGCACACGGTCAATCGTCAGATCGCCTCACGC
CCACCGTCGGATTACTGGAACTATTGCAGTGTGTTGTATATAATAAACACGTTCCTTCAA
TTTGGTAGAACCCATTAATCCTCTGGGATCAGGCAATGTTCGTAAAGTGCCTTGCCCAAG
TACAAAACCGACTAGCTAGCGACCAGTTTCCTTTCGATTGAAAGGCGACGCACTTAACCG
CCAGACTAACCGACCCGACATATTTTAATCTGGTCATTCGACAGAAAACAAAAAAATGAA
CCAATGGTGATTATCTACTTTATTTAGTAATATTTAAGATCTTTTTCATTAAATGTGGTC
GAAATAGAAGCAACCTTCAAGCGTTGTGCTCAAAAAAAGCTAAATGTTTAAAAAAACATC
CGTTTTAAGAAGCAAAAAATACTGACTGAACACATTTATTGAGGTAAGATTTCTTTTTTA
AGTAAATCACTTTTCAACTCATAGAGATCGTATATACATCACTTTTCCACTCATAAAGGT
CGTATGTACATCAATTTTCTACTCTTAGAGATCGTATATATATCGAATTTTAACTTATAG
GAGATCGTATATACAATTTCAACTCCTAAAAATCGTATATATATATATCCATTTTCAACT
CGGTAAAGATCTCATATCTTTCAATTTTCAACTCATAGAGATCGTATATACATCAATTTT
TAACTCATAGAGATCGTATATATATCAATTTTCATCTCATAAAGATCGTATTTATAACAA
TTATCAACTCGTAGAGGTCGTATGTATATCAATTTTTAACTCATAGAGATCGTATAAACA
TCAATTTTTCTACTCATAGAGATTGTATATACAACAATTTCAACTATTAACGATCTTATA
TCTATCAATTTTTAACTCATAACGATCGTGTATACATCAATTTCAACTCAAAAAGATCGT
ATATATATTAAAATATCGAACTTTTACTCATAGAGTGTTGATAGCACGAGTATATTCAGG
TAACAACCCGAGTTGATTTGTTAATTCTCAGGTACCTAACCTAAGCACGAGAATTAAATT
ATAATAGTGAAGTTTAAATGCGCGAAAAGCTACCGATGTAACACAACCAGCTCAGAAGCA
TCGAGAGAAAAGTTTTTGTCATTGATGTCGTGTGATTTCCATTTAATACCAGTTTTGAAG
CGCTGGAATGTAAGAAGTATGATTAGGGGATGTTTCAATTATACACAACGCACTGCTATA
GCTTGTGATCTGACAGTGGGCGCGAGGTAATCTGACGATTGCATGTTTGTTAACGTAACT
TGCGTTTTTCCATCTACGGGGATAAACATGAATATGTCCGACCGGTTAGTCTGGCGGTTT
AGTGTAAAGTCTTTTAACCGAAAGGTTGCAGATTCGACACTGGTCGCCAGGTAGTCGGTT
GTGTCCTTGGGCAAGGCATTTAGTGCCTGAATCCTGCGGATTGATGGGTTCTACCAAATT
TAAGAAACGTGTGAATCATACGCAAAACACTGCAATAGCTCCGGTAACCCGACGGTGGGC
GCGAGGTGATTGCCCGTGTGTTAACCGCTTGGTTTCCCATTCACAGGGATAGACATGAAT
ATCCTATCCTAGAATTCTATCCTATCCTTTTTACCAGTTTTACAATCAAACACATAGGTA
TAGCAAAACACAGCTTACCTCTATAAGAGAGCCATCTCCCACGATCATGACGTAGAGAGC
CACGCCTGGGATCCATAATATAGAAGCAAGGGATAGCACCCAACCTACTCCATTCGCCCA
CGTTGGATAAACGTAATCACCCACTTTCAACGGGACCCACTTTGCACAGTAGAATACGAA
GATTGCCTTTGCGTTATGAAAACGTTTGTTAGTTGTTTACAAATTAAAAAAGTCTTTTGT
ATGGTGAAAATGATGTATTCAGCATTAAAGATAGCCTATTTATGTTTATTCATGTGGTTG
TTCGCACCGGGTTACTGGAGATATTGCAGTGTGTTGTGTATGACGCTTATTAAATTTTAA
TGGATCCAGTAATCTACTAGGTTCATATCATGTCCTCTAAGTGCGTTCTGCATAGAGTAA
TCATCTAAAGACAGTTGGTTTCGATCCCACAACCTTTGAGCTGACCACTGACGACGATTA
AGGCAACCAGACGGACGAACTGATACAGACTATTACTATATGCATTCAAATGTTTAGAGA
TATGTTAGGATGAAATATTCATGTCTATCCTCGTGAATGGAAAAACCAAAGGGGTAAACA
CAACACCTAAAAACACCTCTATCATAAATTGTAATTCAAAATGCGACCTAAACACAT
Chart Advanced