SelenoDB
Release 2.0
Chart Advanced
Sequence Report for SEQ00000469_2.0
Identity
SequenceThioredoxin reductase 2 (TXNRD2)
SpeciesCiona intestinalis (Sea Squirt)
DescriptionGenome -assembly-
Sequence IDSEQ00000469
Sequence release2.0
External IDNone
Gene SPG00000470_2.0
Annotation
Prediction method(s) None
OrientationReverse
Toolbox Forward Reverse  
Sequence
>SEQ00000469_2.0 # Sequence # Thioredoxin reductase 2 (TXNRD2) # Sea Squirt 
GTACTCTATAAAGTATTTTAAACTAAGCATAGTTTTATAAACCATATTGCATATGATCGC
CTAATTAGCGAGTAATTAACGATTACATTCATGTTTGTTTATGGCGCTACATTGCTGTTT
GATTTTCTACTTAAAATGTACTTTACCATTGATTAATCGACTGTATTCGATACAATAATT
TTAACTAAGTATAGCCTTATAAACCATAGTGTATAAAATCGTCCAATTAGTAATTAATGA
TAGTAATGCTTGCGAGTTAAGTAAACTGCCATGCATTGGGAAGTCGCTGGTAATCGGTAA
CTTTTGGCTTTGTTCACGTTAGTATGCAAATATAAACAATAAGTATATATAGTATCAGTC
TCATATATCTCTTATTAAAAGAAAACAAATCCAAAATAATTGTTACGGCAGGCGAGGATC
GAACCCGGAACATGACGTTAGTAAAGCGTCGAGACAAGGGTTATATTGTCTGGGAATTTG
GAGGGCACGTGTTGGTGAGATAAGGAATCCTCACATCGATTCACGCCTGAATCAAACTAT
TTTCATTTAAGTGGGACGCATTAAAAGTTTTTGATCAAGCTCAGTCGACCGTTGTAGTAA
AAGGGTTAATTAATACTATGCTAATTAGTTTAATCAGAGTATACTAAACTAGTATACTGT
TTAGTATACTCTGGTTTAATTAACATGCTCACGCATTAGATCTTTGATCTCTTGTTTTAA
AGTTTATTTGAATAAATGCATAATTTTTTGAATGTTATCGAACAATTATAAAATTTAAAA
CATAAAATATAAATTTTATGTTTTCAACTTTTTTAAAAATAGTTTTATTACTTTTTTGCA
TTGTAAACCATTTCGAACAGATGTCGAATAGACTCGATAATTCGTGCCGAAACAGCCGGA
AGTAGACCGGCGAAAAACTTTGGTTGAGGGCGGAACGAACGCCTACTTTAGTTCATTTAT
AAAAATTACATACCTTTTTAGCAGCCACAGGTTTAAGTATTGAAATATACGATCTGGTGA
TCACATTTATATAAATTTGGACCATCGTCATTGGATTAAAAGTCAAATTTCATAATGGTA
CGTGTAAAGGAAATAAAACTTGTTGATCTATACTTAACCGAATCTTATCTATTACAACGC
ATATGTATCAGTGTATCTTTTAATAAATTATTTTACCGCAGTCAACGACTTTGCGACCGT
ATTTAAACGCAGTTCGAGCGACATTAAATGCCTCGATGTGTTTGGAGAATTTCAACTCAC
AAGTTGTGGAACGTCATGTTAAACCAGAGGTAATATTTTGGTGCTAGTGGAGTGGTTAGC
AAATACGGTGGGGGGGGGGGAGATTCTTCAGTAGCACCAATATTTTGGTTACACCACTTG
CATATCTATATTTATTAACTGCATATATATTGTCGTGGTAATAAATCATTTTTACCTTAA
GTTACATGACATGCATATTAAAGTAATATTTTACAATAGGACACACATCATTGTCAGACC
TTGTCCTGTTATGTAAGGAATAAACAAATTTCATTTAGAATAAATTTCGAGTAAGTTGCC
CAACGGCAACAACTTGCAATACAGCTTCATTTATCCATTATACATTATGCAGGTTGAAGT
AAAAACAAGCAAAGAACTTCTATTAACACCACTCGTAATTGCACGAAATGAAAAAGAAAA
AGTTTTAATTGAATCATCCATTAACTCCATTCGCGTCAGTATTGCTGTCAAACAGGTACA
TTATTAGCATAAACTTTATTCTCTTAGAAATGCGATAGCTATGTAGTCAAGCTGGTGACA
ATCCATAGCCCATATTGGAATAAGGCATTTGTGCATTGTTAGGTTTACCCCAAAATTAAT
GCAGAAGTCTTATATAATGGCCTAAAAAAAATGTAAAAAAATATTGCTTTTAAAAAAACA
AACTTTTTAATCTGGTCCCTAGCTTTACGATTTTTAACCTTTTTAACCTATGTAACACGA
ACACCGTATGTGTAAGAAATTTCATAGAAAAAATTACAAAACATGTTTTAACACAAAACT
AAAATTGCTGACAAAGATTCAATGATTGGATTAGTAATGCCAATTAGGAAATGCTTAATA
ACCGTCACAAGACTCTGCAAAACATTGGTTGAAAATCACAAGTGTAGCTAGCTTACCAGA
CTAAGTTTACTGTGGTGGCCTCAAACCTGGTTTCAAATGTAAAAAAAACATGCAGTTTAA
CATGAAAGCCAATATAGTCAGTACAAAATTATTCAAATTCATATTAGTCACTATGAATGT
TGAACAATTGAATATTTTTAATGCATTTTAAACTTTCAATGGCAGGCAGATGAAATTGAA
CAAATTCTGTGCCAAAAGTTCATGAGGTTTATGATGATGAGAGCTGAGAATTTTGTTGTT
CTACGAAGAAAACCAGTTGAAGTGGGTATCATGTATAGGAGAAGTTTTGCTATAGCCATA
CCCATTTATATGTTTAGAATGTGTGAATACCAGTCTTCTGTACATGTGTACAATTCCAAT
TTTAAAATTAAAAGTTCGATCTTAGAAATTATTTCGGATCTACAAATCAATTGTTAAAGG
CAAAAGCAGAATGAAGTATTCCTTTTGTCTTAATCTGCCACCTTGTTTAGTTTATAAGTT
GTAAACTAAAACTAGTATGACAACTATAGTAATAAAGCATATACATGTATGTTTTATGCT
CATGTAGTGTGTAGTGTCTACAACAATAAGGTCAATTTAAGCTATACTTTAGCTTCAAGT
CAAGGCTTTTCCTTAATTGTGTATTTACTATTTAACTATTTTTTTCTATTGCAGTCTGTG
TGTATAACAATAAGGAAACTTTTACTGGTAATTATCATTTGTTTTGATCTTCAGGGATAC
GACATCAGCTTCCTCATCACCAACATCCACACGGAGCAGATGCTCAAACACAAACTCGTT
GACTTTGTGATTCACTTCATGGAGGAGATCGATAAAGAAATAAGCGAGATGAAACTCTCT
GTGAATGCAAGAGCAAGAATCGTAGCAGAAGAATTTTTAAAAAAGGTGACTTGTTATGGC
AGTTTGGTATACCAATGTAAAAGCTATGAGTTTCTGCCCTGGGCCTGGTCACTACACGTA
GTGTTTTTCACTTTAAAAGCAAACTTGTGGTCAGATTTTTAGTATGTTGTCATGAAACTT
GTGTATTTGTTACAACAATAAAATAGATTTATTTTTAATTTCATGTTATATATATTAAAC
TACACTTCTGTAAATTAGTTCTTTAATGTTTCTGTATGATTCAGGATGTATATTAATTTG
CAAATTTTCTTTTTACAGTTTTGAAACATTCCATGAGGTGCCCACTCAAATCACTGCACT
CGCAAACAAATTTCAACAAGATTTTATTAAAAGTTTTGCTAGAGCAAAATCTTTGCCTGA
TGCACTTGTGTAACTGTTTGCAGCTTTATTTGTTCTGCAGCTGCTGTATATTAATCAAGA
GCAGTCATAATTAAACCTATCTCATAATAATGATTGCTATCCATGACCAGTTATATTGAA
TTCTTATCACAATTAAATGTTACTGGTCAAGTTTAGTTTGGTAAATTTTCCATCATACCC
AGCGATTTTGGTTCTGAAATTTTAAAGTCCTTTTTTGCCGTATTTAAATTAATTTCGAAT
ATGATTATGTACGCAGTGTAACGATGTATATATATGTGATATTATAATGGTCAAAGTCAA
AAGATCGTGGCAAATTTTGTGTTACTTGATTGTCACCAAACGCATGGTATTATTATTCAT
GCAGTTATTTTACACAAGGTTCTAGGAATTCAGCTAGATTTAGCCAATCACCCCAGCACC
CTGATAGTTAAGTACACCAGAATGGATTGCGTTTTAGGACAGTCGTTTCCAAACTTCCTA
AAAATCTGCCTGGTGGACCCTTTGCACATTTTTTGATATTTCACAGCCCTATAAAAATCA
AAGAATGCTATCCCGAAAATGCAAAAATCATACCATTGAAATAAAAAGCAAAAACTATGA
AATATCTCTGAATAGCAAAAACTATAAAATATATCCCTCTGAAAACTGCTGTGCGGAGTC
CGTAGTTGGTCCGCAGAACCTAGTTTGGGAACCGCTGCTTTAGGAATTCATGCAACCGGT
GACTCCTGTCTTGCCACAACTCAATGTCCCAAAGTGATGTTCTCAATTTGTAGTGTTTTA
ACCCAGAAATTTAGGCAGCTAAATTTTAATGTGGAAGATCTACACATTAAAGATGTTGTT
TTTTAGAGGATACTTAGAAGCAGCCCTATTGTTTTTAAACACTTGTAACTATGCTCCAAA
GGCAGGCGTTTTTAAGTTCTACTGATTCAATTCTAGAGCCTTTTATTCACATTGCAATCA
CACACCTGTGAACTAATTGTACAGTGGAGCCTTCATAATTTCTGTGAGGGAACTTAAAGT
CTATTCACATATTACACCAAAGGCAGGCGTTTTTAAGTTCTACTGATTCAATTCTAGAGC
CTTTTATTCACATTGCAATCACACACCTGTGAACTAATTGTACAGTGGAGCCTTCATAAT
TTCTGTGAGGGAACTTAAAGTCTATTCACATATTACAGCATTACGCTTTGAGATCGGCAA
GCAGTGATTTATGTACAATAACACCAATACGCGTAAACAGGAATTAAATTATTAAATAGT
TTAGGCATGAATTTTCTAACGCAAAGAAATGAAAAAGGCAAGCGCAATGTTTTAACTCAA
ACTGCTTCAGCCACTAATAGTGGTTTAAGAAGCAATCGTCATGAAAGTTGCTTTCAAGAG
AGAAAACAACATAAAACACCGTTGCTTGCCAGAAAAGTAAACCAGCTGCCAACCAAGTAA
CCACCAGAACTAAAACACGATCCTAAAATTTGAGGATGTTTTTCAAATTGACTATGGCTG
TTGCGACAAAAAGAATTAGAATTGTAAGCCAGAAATACTGATCATTAGATTGGTGGTTAC
TTAGTTATTGCAGCTGGTATTTAACCTCAGCAACCACTTTGGTCAATGGCTGCACCAGAT
CTCTTCGTTACATTTAACGTGGTGAAGAGCTGTAAAAAAAAATTTAGTTATTATATTATC
AATAAAGGCATCTTATATTGTATAGTCACTAAAAACTCGAATAAGGTAAAATAATGTGGT
TTTATGATAGTTATTGAGATTATACAAAGTATAGTAGGGTGAGAGAAGATAGGGCACATT
TTCTTTGGATTTTCTCGTCCAATTTGGTAGTAAACAAAGAACATTTAAAGAATTTTAAAG
CCATATCTTCATGACTCCCAAATACTGTTGTTAATTGGTTAAAACATGATCAGGACATTT
TGAATATTATGTGTTAAAGGTGTCCCATCTTTTCCCACCCTACTATAATATGCTACTTCC
AAACCTCAGCAGTAGTTGGATGAATTCCAATTGTTTGATCAAGTTGAGCTTTGGTGATTC
CACATTTCATGGCAGCAGCAAAGCCTTGCATTACTTCACCAGCATTTGGACCAAGGTAGT
GCAAACCTGACGAATAGTGAAAGGAACATTAAATTTAGTTTGTATTCAAAGGCACTTACA
CTTTCTCTCAAATGTAGAGCTTAGAAGATTAATTAGTTTTATCTGATACTTAAAGAGTGT
ACAGTAGTTAATAGGTTATCTTTTTCATAAAAACTTTATTTGCTGTATTTGCTATTGCTT
TTACAAACAGTGACTTGTATATCATAATATTGAGATATATTGTAGTCAGAAAACAGGAAA
TTAACCACGTAGCTGATATTTCCTTCTCAGTCAGAAACAGAGCTGTGAATTCAGCTATGC
AGACCCGCAACACAATATACAATGGCAAGTATAGAATGCTAATACAAATATCCAATATGC
AGCTATGTATAAGATACAGTAATAGTTGATAAAGTGGTATATTGATTTTGGCTCACCAAT
CACTCTTTCACTGTCCAACTTGTTGGTGATAGCTTTCACATAACAAGTATTGTTGTCATG
GCCAGGCACTGACCATTCTAATGGCCACACATTTGTGTGGTAGACCTGAATGGAAATAAA
GTTTTTGTAATTATACAATGTAGCTCCAATTAAATGATAAATCAATGCAATAAACAGGTT
TTCAGTTATCACTGCTGTATGTTATATAATATAGGGTATTCTCAGTGTTTATATAAGTGC
TAATTTAAATAACTCACTTCCAAGTTGTCTTCTCCATACTTTGCAATAGCTGCTTCTTCT
GAAAGTCCACAACAACTGTATTCAAGTGGAGTGAACACTGTAGTGGGGACACCTTCGTAG
TCACACTGTTGGTAAGTGCAAGTCATTTATATCATATATCATAATTGAAGACGTCAAACA
CATTTAAACCTAAATTTATGTAAGACAAAGCTGATACGCCATCTATGGTACTATAAAAAA
AAGCAATTTTTATTAATTACACCCAAATTTAATGCAAAAAGAGAAACCTGATTGATTGAA
TAAATGTAACTTAATTAACCTCACACTACACTCTAACCTCTGATCTAAAGGCACCTTCGT
GTTAGCCATATATCACAATTAAATACATATATCAGTTTGTATGTAGCATACCTTGAGTGT
TGAACCACCATATAATCGTTCTGATAGAAGTCGACCAGCATGGATTGCTACAGGAGTTAA
CTCTGGTTTTCCTTCACCATTGTCTCCAATGCAGAAAATATTTTCCACATTTGTTTGATC
ATAGTCATTTACTGGAACTTTTCCATTTCTATGGGATTAAACAACAAAAAACATTAGCTT
TAAATATGTTACATACTATTCTATTAGGGTGAAGTCCTACAGTAGGGGCATGAGAGGAAA
TTACAATTTAGGTCTAACTTTACCCAACTTTTTTTATTACTCTAAATATCTTTGTAACTT
GGATGTTCTTGTATTAAACCATTGAAGAAAATGAAAGTGAAAATGCGTAAAAGATTTTCG
AATTGGGTAGGATCATGTATTATGCAAGACTTAAATCAAAGTGTGATTCTAAACATATAC
TATATATCAAATATAAGGACGGTTGCTTTTACTTGCTAACTTGAACATTGATTTTGTCCA
ACCCGATGGTTTTGGTCACAGAGTCTCTTCCTATTGCCAGTATAACCTGTGTGTTGGTTT
AATAATAATATATCAATATGTTTACATTACCAATGTAAAACAGACAAAAAATTGGTAGTT
TTAGCTTTTGAAAATTCAGACATTTTTATAAACTACATTCACACAACAAAGCAAGGATTT
TTTTGGTTTATGCAGAGTCAATATTTGTCTGGTAGTGGACAATGATATTAAATTGAGTTG
TCAGCAAAATCTATGCACTAGTCAAATTCATTGTGGTTTTCCAGTGTGAGCTTCACACTA
CATACCAGTCCTGCAGTATTGAATACACAAAGCAATATTACTGTTACTGGTGTATAGAAA
TTCCATAGCGGCCAATATCCGTACCGTGTTATAATCTCCAGTGACTTCCTCTCCGTTTTC
CGTCATTTTCCCAGTAACTCTTAGCAGACCTGGTTCTCCTGCTTCTACTTGCTCTATCTT
GACAGGAACACATCTGGAAACAAAACCGGTTTACAGTTCATAGAATTGAATGAAATTTAT
TTCATCTCTTCAGTCACGATAATAAGGACCAGGAAAGATTACAAAAGCAAAATGACAGGT
AGAAACAGTAAAACGACACATTTAAACACGCTTGTTGATAAAAAACAAGAAATTATGTTT
TGGATAAAAGGGGATTGAACAACTTGTGTAGATATATTAGTTGCAACTTGCAAGTGGTAT
TTTATTGGTGATGCCAATTTGCAATAATAAATAATTTAATACCTTCTTAGAAACTGCACT
CCTTCTTTTTCCATGTAACCAGCTGCTTTATCTGCCATTTGCTGGTCGAATCCTGTTAAA
ACCAGTTTTGTTGATCGCTGAAGAATGACAGTAAGACACAAAACAACACAAGTATGACAC
AGAACAACAAACTTATATAAATGTACATATTTCTTACAAATGCATTTTCCCACCAATTTA
GAAATCTAATTCCTACTGGTTAAACAGCTCAAATATATTAACTGACCTCTTAAAAAGATG
GAACGAACCATAACAGTTACATCAAGTCCAATCCCTTTTAAGAACCCAGCACATTCCAGT
GCAACATATGATGCTCCTATCACCAGTGTCTTACCAGGACAGTATGGCAGTGAAAACAAG
TCATCACTGAAAAAGTAAAACGTTCAAATTCATTATTTTGTAAATGCCACTTAAAAATGA
AATAAAATAGTAACAGATTAGTTGCATTTGTAAGTCCGAAAAAAAGTTTAAAATATTTTT
GGCATGTTAGGGCAACATACTTTCAATTTGTGAAACGCCTAGATTGGTAACAGATAAGTT
TAAAAAGGTTAAAAAAGGTAGTTATTACCTTGTAATGCAATGTTCTTTCGCACCTGGTAT
ATCAGGGTAGCGAGGTCTTTCACCAACTGCTACGATGAATTTATCTGCAGTCATCTTTGT
CTCTTTACCACGCCTGTTCACAGTCTGTAATAAACAATCATGTTAGTTAAATGTTCATTG
TGTGCTCTGATAAAAAATACTTTTTATTGAGCGTTTATTCCTAATTTTTTAACTATAGCA
AAAACAAGATAGTTCTACATGAGTGAATAAACAATTACCGTTATAGTGTGTTGGTCTTCA
AACTTTGCATAAGCGTTCACATAGTTAACTTTCTTCTCCCGGAGTTGAACCCGGTACCCC
CAGTTTAAAGAGCCAATGTAGTTTTGCACAGCTTCTACCATGCCCTCCCATTTGTTTTTC
ACTATTTTAAAAAAGAGTTATGTACAGTATTTATGCTAAAACTGAAAAATGTGCACCAAC
TCTGGTGAAATTTATGGAATATTAAAAAAGAGAACAATGCATTATTAAAAAATGTAACCC
AAAAAGATATATCATATTTACCCTTAATATCCACACATAATAGAAAAATCCTTCAAACAA
TGAAATCATTACATACCTGGTTCTGAGGTTAACTGCCATCCAAATGACTTTGCATCTTCA
ATGCTTTTACCCAGCATTGAAGCTTGGTGCATAAGTTTCTTTGGAATGCAACCAACATTG
ACACAGGTGCCTCCCAATCCCCACGAAACACCCTTTGGGGTTGGTTGGACAAAGTCGCAT
ACTGCCACCTAAACATTATGTTATATTTATATTATACATTTGATATTTTTATGTTTACAT
ACCATATAGATGTTGTTTTTTTATGTTAATTTGTGTTTTTATGTTAATGTTTATACAACA
AATTATCACATTTTGCCTTCCCAATCATACATAGCCCATTCACTTTGTTGTATGTTTATA
TTACCATTAATATAGTATATGAGACAATATATGCAAAACTTATTTTTATGTTAAGTATAT
TTATTATATATACCTTTTTTCCAAGTTCACTTGCTCTTTTGGAAGCAGCCAATCCCCCAG
AACCACCACCAATCACAATAAGATCGTATTCATATTCATGGGTGGATGAAGGTGCCTCAA
TCATTTTTAACAACAGGCCCTCACTGTGTGCCTGACAATATAAATACAATAATAATGTCA
GGTGTCAATACCATATCTTCGTGAAAACATCTGCGAATGACTGATCTGTTCTTTTGGTTA
GGTGGCTTGAATGGTGCAAGCTACAAATGTATTTAATGTGATGGAAAAAACATTGTGTGC
TAATCAACAATTACCCTTAAATTAAAGAATTACTATACTTTAAGCACCATCAAGAAATAT
TTAACAGATTAAGCATGAAAGTACAAACAATAACATAGGCCTATTTAAAATGTAACATTT
GAAAATTACTTTAAAAGTTGCATCACAGCCCCCCAAGTGCCGGCCTTTAATGTAAACATT
GGGAACAGTTTGTTGTCCAGAAACTTCCAACAGTACTGATTGAACTTCAGCTGAATTTTC
TGCAAATTATAGTATTGTCAGTATTCTTAATGGGGTTTTATGACATAGAGTCTTGGGAAA
TAGTAAAATATCTCATTCCTACCAAGTTGATTAATTTCCAATGCCTTGTATGTAACTTTT
AACTCATCGAATAGGGATTTGACCTGAAAAGATTTGTAAATGTATTCAGACATTACATCA
AACCATTACCAAAAATATCAATTTACCTTAGAGCAAAATCCACATGTAGTTTTACTGAAC
ACCATCACAGGATTATCCTTTATGTTCTGCTCGACCAGCGACCTCACGTTTTCCGTAGGA
GGCATCTTGGTTGAGTACGTTGTCCACAGACTCGAATATATCTTTGTGTAACGTCTGAAG
CCCTATGAATTATGCGTGTAATGATTTTCCGCTCTGAAATTTACATGCATGAGTACAAAA
TCTACGCTTACCGATAAAATAAATGACATTCAGCGCGTTGTTTTGTCGTCGTTTAATTGA
TAAAACGATTGTAAATTAGAAAGTTACACCCGATTTTTGCGCGTTCTATCGGTAATTGTC
TCTTTCGCTTACTAGTTATTATCTACACACATTACAAAGCGCTTGCTCATTAGACGTGAA
TGCACCACGCGTTGTGTTAATGTTTGACCCAGACGCGAATTTTACAGAAATAACTGTGGA
GTCAGAATGATGCTGCCTTTTTCGCGGGTTCCGATTGGGCAGGATTTTGTAATGTCATGT
TGCGTCAGTTCTGCAAACTATGAATTGCGAAAGCGGTAATCACCGACCTAATCCGATATT
GTCCGATTCTCACGTTGGTTTCTTTTATTTTACGCATACTTTTTCTTTCTCTACAGCCGC
GCATGCTTTCTATTGGCTAATTATTGTGGGCGTGTTTTTTGCTAACATCACGCCCGCTTA
CCATTAAAAACCTTGTACGGTATTACCGTATTTACAGAGAAGCTACAGTGCTACACGATC
ATAAACTTAAAAGATGCTGCGTCAGGCGACTTCTAGTATTCTATCGCAATACTACACTAA
AGGAATAAAAACAACCTTCTTAGTTCGGCAAGCAAGTACTGCAATACCAAACGCCAACTC
TCATAAAGGAAAGCTTTCGGCTACCGAAATAATTGAGGTAAGCTGTCGTAAAAACTTCGG
TAAAGTTTGTTATGCAAAATTGTAGTACTAACCTAAGACATAGATGTTTGTTTTTTATAC
TGTACACCCCTTATTTCCCTTGTTTTCAACTAATATTGTTAATAGTGAAACAAACCGTAG
TCACTGCCTTACCATCCAAGTACTGTTTGTCACACAAATCTTGCTGTTTATAAAGAGTTA
GATAAAATCGGGTTAAAAGTTCAGTTCTGTACAATTATTAACTTACAAGTGTTTGTCATG
TCGAGTGCTCGTACAATGAAATTGAATAATGCTACATCACATTTTAAATATTTATGAGCA
AACATAAAAATTATGGTTATTTCTATAATTCTATTGTATTTCATAGTTTAAAAATTATTT
ATCAAACATATAATCTTAATCACTAATGCATATAGATTTTATTCAAAACTTTGTCCTGTT
TTTTATTCCTTGGGCTTTGGGATAAACGGACATTAACGTGACAATTAAAAACAATGCTTT
CAAAAGCAACTTATCTTAATCTTATGAAACAAACATTATTAATGGAAGTATAGGGTAATA
ATACAAATACTAGTCATACAACTTAGATATTATGCAGTCTATATTTTCTGAGAAACCTCA
ACTTTTCCTCTTTTATCCACAAAAGCGAAATATCTCCTACAAACTTTTAACAGTCTTGTT
CCGAAGCTTTTCTTTTATAATTTATTATTTTTATTTAAGCAGTTGCTTTTAAACATAAGC
TTACCCGCAAATAACGTCTATTTGACTAAAAAGTCCCGAGTTTCATAACCTACATAAAGC
ACAAGAAGTAACCAGAGCATTACGCTTGGTCTAACTATACGGTAAACACTTTTGAAAATC
TAAATGACATTTTTGCTTTATCTAAACTAAATTCAGCAACATAATGATAAAAATCACCTG
TAACTAAACGGTCTTAACTTAAAACATAAATTACATCTTAAAAACAATGCTTATAAATTT
CATTCATTCATACATCATCAGAAAATGTAGGCAGAGCTGTAAAAATCTTTTTTTATACAT
GATTACCTTTCTCAGTTAAATCGTTAATTAAATTAAAATAGTATATATACATACTGATAC
GTAACTTTAAAATGAATTTTATCACAAAGTGAATACTGGTTGGGTTAGAAATAACAAAAC
AGAAAAAAAAACACAGTTGTTTTTTACCCCTCTTCAAAAGGCATTTTAGAGTGAAAAAAA
CAAACGAAAAAAGTATGGAATGTTCGTAAAATTTAAAATTAAAATATACCAGCAACAGGG
TACTTAAATATATAGAAAATACCTGCATTCCTAATAAATCTATTAAGAAAGACCTTCTTA
CAAAAAAAGTTTAGCAAACCTCATAAAAAGTTATTTGTCATATTTTGTTTGATTAAATAA
TTTGTGTTTTATCGAAAAAAAATTACCACCTAGAAGAACAGTTAGAATATAAAATAAGCC
AAATTAATGTCCCTTTTACCCACAAAAGCTGTTCGCGATAAAATGTTTTTTTAGCAGGCT
AGTAAGGTTGTCCTTTCTTCCCCCATTGTTTTTTATTACCCCACTTTACTGTGTATGTAT
AAATCAGAATTAAATTTATTTTGATGAATTATAAGACTTTACTAACAGAACAGATTGATA
TGTACACTCTTAGTTATTAAATTCATTGTATATATAATTTGCCTTTCTTATCACAGAGGG
AACGTCAGTATGGTGCGCATAATTACGACCCTTTACCAGTTGCCTTATCTGCGGGAAAAG
GTGTTCATGTGTGGGATGTGGATGGGAAGAAATATTTTGATTATTTGAGTGCTTACAGCT
CAGTCAATCAAGGACATTGTCATCCAAAAATTGTTGACGCTCTTGTGGTGAGAATTTATA
ATTTGGGTTTGAAACTGAAAGTAGTGCTTTTATAGTTTGGCCAAATACTTTTATTTAATT
CTAGTAATAATATATCAAGAAAGGATTAGTTTTAATACATTTTGTTGCAATTGCACTGGT
AAAGTAAAAAAATAATTCTTATAAAAAAGGATAACCCTCACAATCAATATGTGAAAATAA
ATATAAAAGTTAATATGCATGTTGATAGAGCCAAGCATCAACACTTGCAATCACTTCAAG
AGCTTTCTACACAGATGTGCTTGGAGAGTTTGAAGAATATATAACTAAACTCTTTAACTT
TGATAAGGTCTTACCCATGAACTCAGGTAATCATGTGCAGTATTGTTATAGCATAAAATA
TCGCAATTATTAAGTTATACTTTACACAGATTTGACAGAGAACGAATCAAATTCCTAATG
AAATAAATCAGTATATAACTTACACTTACTAAATGCTCATTATCAACTGGTTTTGAATCT
GTGAATCAGTTTTGATCTATTAAATGGATTACAGGTGTTTTATAAGACAATTCCAAGCTA
AATGAATGTAATGAATAAATGTAACTTATTTTATCCTCACGTGGCCGGAAAACGACAGTC
ATTATCACATGGGTTTTACCTCTGGGTTACAGGCAGGCACACTAACCACTATGACACGGC
GCCAGACAAATAATAACTGAATGTTTATTGCAGGTGTTGAAGCTTGTGAGAGTGCATGTA
AGCTAGCTCGACGATGGGCATATGATGTTAAAGGTGTGCCTAACAACGAGGCACGGATTG
TGTTTGCTTCTGGAAACTTCTGGGGTCGATCACTTGCTGCTGTGTCTGCCTCAACAGATA
GTGACAGCTATGGGGGGTTTGGTCCATACATGCCAGGGTTTTCTATTATTCCTTACAATG
ACCTCTCTGCACTGGAGGTGTGTACTTCATCCCTTTTCATTGGTCTATAATAAAGACAAT
TTATGGTGCGGTAATTAAACCATTCCAGCATATTTTAATGTATTTTTTTCCCTAAATTAT
TTTGTTTATTAATATTAATGTTAAAAATTTAAAACTATTTTTTCATATTTGTTGCAAAAC
TAGGTGGAATTAAAAAACCCGAACACAGCAGCATATATGGTTGAACCTATACAAGGAGAA
GCAGGGGTTGTTGTTCCCGATGAAGGATATTTACGAGGTGTTCGAGATTTATGCACCAAA
CACAATGTGTTGTGGATAGCGGATGAGGTAAGAGTGGTTGACATAGTGTTTTAAATTTAA
GCTTTAACTTAAGTGGCACTTCATATGTGTGGATAATGAAGGGCAACAACAAATAAAATA
TATTTTTCATCTGAATAATGTAAGGGAACACAAAACCATTTTCGCTCATGTAATATTAAT
GATAAAATAAAACTTAAGCAGCTCATTTAACAAGTGTACAAACACATTCTGTAGGTTCTG
TATAATTAGGAGATAACTGGTTTGTTCAGGTTCAAACTGGTCTTGGTAGAACTGGAAAAC
TCTTGGCATGTGATCACGAAAATGTAAGGCCCGATATCCTTGTTCTAGGTAAGTATTATA
ATGGTTTGTGTTCTGCAAATAGTGCTGTATATTTGAATATGTGATGTGGTTTCATTCTAC
TTAATTAAAACAGGTCAATAATATTAAGAGTATTGTATTTTAATATAAGAGTATTGTATT
AAAATGTATGCCTAAAAATTGTACACAACAGTATGTGTGTTACTCTGCACAATAACACTT
ATTAATTTAAAAAAAAAAGGTTGATTTTTCTCAGGTAAAGCATTGTCTGGTGGTATGTAC
CCTGTCTCAGCTGTGCTTGCCAGAGATGAGGTGATGCTGACTATAAGACCGGGTCAACAT
GGATCAACGTATGGTGGAAACCCTCTTGGCTGCAAAGTGGCCATGGCTGCCTTGGACGTA
AGTTTTTGGAAATATATGTATATGGTTTTGCATGTTGTACTTAAGCTAGCACTTATTGTG
GAGCTACTGTGTTGCTTGATATGTGTTATTAGAAATGTTGCAAGCCAATTTTACATTGAG
AAACATGACACTGTAATATGATGACCCTTTGTTGTTATTTAATCATTGAATGTTTGTGTT
TGAGCTGCTTTTCCTTAATTTTACTGCTTAGGCAATAAAGGTTTACTTTTTACCTAACGG
CGATTGCCCCAATCCAGTGGTCACTAATGGGTTGTCTAAATTGTCAACAACACAATATAA
TAAAAAAATATATATAAAAAACAATTACCTATTAAGTTTGTAAGCGGGCATGAGGTGTAT
GAAAACAGAACACCTATGTTATAAGTTAACGACTGTTGTTTACCGGTCACACAATGGTAA
AGCAAGTTACATTTAAAGTAAA
Chart Advanced