SelenoDB
Release 2.0
Chart Advanced
Sequence Report for SEQ00000453_2.0
Identity
SequenceSECIS binding protein 2 (SBP2)
SpeciesCiona intestinalis (Sea Squirt)
DescriptionGenome -assembly-
Sequence IDSEQ00000453
Sequence release2.0
External IDNone
Gene SPG00000453_2.0
Annotation
Prediction method(s) None
OrientationForward
Toolbox
Sequence
>SEQ00000453_2.0 # Sequence # SECIS binding protein 2 (SBP2) # Sea Squirt 
GTTATGCAAGAATAATATTTTTAATATCTCTTTTCTATTCTGCAGAATATTTCAGGTCCT
TACAAGATCTTGCTTTTCTCCATATTTTTCGAATGCCTTATCCCTATTTTTAAAATATGG
TTATTCTTATATTTTATATAATATTGTATGTTGATTATTTTATTCAATTCATGTGTATAT
ATATATGTTGTTTTTATCAAAGATGTTTATCCTTATTTTCCAAATATCTTTATTTATGTT
TTTCACATATGTATATCTCTATTGCAGAAGGACCCAGTACCCCAAGTAATCTACATCACC
CCAACGAACGTGGCCCCACCAGTGTCTTTATTCCAAGTTCATTCATCCGCCCATAACCAT
ATGTTCCCTAACTCATTACCCCCTCAAGTTACCCCACCCCCCAACAGTTTGTTGGGTTAT
GGCCACCCAGGTCCCCCCATTATACTTTCACCCCCACCCAACCAAATACTGGGTAAGTCA
AATTTGAAACTCTGAATAGGATTTTTTATGGTAAAAAAAACATATTCAAATTCTTTATAG
CGTGTTTAATTATTGGTTGTCTTCAAATCAAATAAAACTATGTCATTTTCCATGTTTTTT
TTGGAATTTTTAGTAAAACCTTGATTGATATTGTTAAATGCTAAGTAAAAGGGGTGGCAT
GGTTTATATGCTAAAGTTTCTAATATGTTCCTAATATCTGCAGCTAATCGTCCTACCCCT
CCCTTTCCTATCCATCCCAGTATGATTGGGAATCGCAATCCAAACCAGGTACAACATTTG
TAAATTCTATTCTATATGAATGGGTGGGGTCCTTGAGAACCTAGGTTGTAGGCCAGGTTT
AGCCCATTACCCCAAACATACAGACTAATTTTAAAAGTATGAATTGAACATGTGACTATA
GTCCTTTGGTCTGCACTTTAAACACTATGTTTTAAAATTCTTGTGCCTAATTGTTTCATT
CCAATTAATGTGTACAAAATTGAAACATCACTTAATGTTTATGTGTATATAGTTTGGTTT
ATTCAATCCAGAGTTTAAATGCTCTGGTGGTCACAATCAACTGGTTACAATGTACATGCT
TATACTAGGAAGGATAATCTAGCCTTATGTTATAACATCCTCTTGTTGTCAAACAATGCT
TTCAAAGTAAATCCTCATGTCTGTTAGTTGTAAGAAAAGCGCAGGAACCTTTAGTATTCA
ATGTCAATCAAGTTATATATCATAACGGCTTGTTTCAAAATTTAAATTATTTCAAGCTGT
TACCTGTTTACTAATACTCAACAAACCAATACAAGTGCTGAGTGCTGACAAATATTTATC
TTAATAATGTTAACAATTGAATTGTCTTAACTCTGAACCGCTATACATTTATTTAATATT
TAAAAAAACTAAAAAACTAAAACACAGTATAGAAATTAAACTTGTTTTCTAAAATTACTC
TTTTGGCAAAATGTATGTGTGCTGTTAAGTGCGATTCTCCCTGATGAACACACCTGTATG
GGACGTTTAAATGTCAGTTGGCAAATAAATGACAAAATAGCAATTTTTAAAACAATTGTA
ATATTCCTGGCAGCAACAGTTTTATATATTGAAATCTAAATTATAAAAAAATAAAAGTTT
TTTTTTTTAACATTTGGTAAAAGTCAACCAATTAATACCAACTGTTTCATTGATGTGTCT
GTAAAGAATATAATTGAATGACACAAAACCAATGTAACCTTAAACCTACAGTACAGTAGC
ATCACCAATACAAACATGCTAGTCATGTGGTTGTTGTGTCAAATATTGATGATTATGTGT
TTGTATTAGACATATTGTGGCCGACTGTGGTTCATTTTATATTCATTTAACGTTAATATT
ATTAATGTGAAAAATAATACACTTTTGATTTCAATCTTTTAGTAAAGAAATTGCTGTTCA
TTTTAACAATATAGATTTTATTTCTAAATATAATATTTTTAAACTGAATTTTTGGTTCAA
GCAATTAAGTAACTTCATTTAGCTTTTAGTGTAAAGTTAATGTCTGCATCTGCATGCACC
CTGTGTGACTATAAAACTATTATTGTTGTAGTTATAAATGGTGTATAAAAGACCTAAATT
GAAATTATACCAATATTTAATTATGAATTACAAACATTAATTTAGAATACCACGATACCA
GTCACCACACAGCTTCCTTTTCCCTTTATTAGATCATGAAATATAAATTAATTAAAATAA
TGAAATTAACAAGTCTATTTGGCGCAATTTAATTTTTTAAATCCAAATTAAACATCCTAT
GCAAGTCACTTTAATTAGGGTAATACACAAAACAAGGTTTTAAATATCCATCAATATTAT
TGTTTTACACAAAAAAACTGCAAAACGGGATTTGATCTCAATGTACTGTTTGAAGAGTTT
TAACTAAAGAATAAAATGTAATAAATTATGAACTTGTGAACATGTATAGGGTAATGGTTA
TATAGTTGTTAACATTGCTTAAACACATTCAAGAATTCTCCCATAATTTCAGTTTTCCTT
AATGGATATCCTTTTCCCCACAGTGCCCAAGCAACAACAACTGGAACATAAACCAACTCG
CGTTACCCCCCGGCTACTGGCCCAACAATTCCACCCACCCCCCACAACATCGACATCAAA
CACGAAATCCCTCCCTTGATTTCCGACACCAAAGAAACCTAAAAAAGTTTGAGTTTTACG
GCGAGCAGCCATATGTTTCTGCCGCTGGATCCCAGTTTTTGCAGGGACACTTCGATAAAC
GAAAGCACGACAAACGGAAAACAGTGGATGAGGTTCCAAGCCGAGAACGAAGTCCAGTTG
TAATGCAAACTCACGAGCAACCTAATACGAACAACCTGCACTTCCATGGGGACAACTCCA
TGATCATGCTATCGGTAGGGATTCAGTTTTTGTGCCATTGAGTTAGCTAAATATTAGAAA
GTTGATTGAAACTAGATTTAAGTTTTTAGGTACATCAAGCACAGATTTTTTGTTTAGTTT
CAATAGAAGCTTTACACCACATGTATGACTATTGTTTCGTTTATACACTTCGGTTTAAAA
ATAAAACCGGAAAAAGTTAAAAAATACTATTTTATTTTAGTAACACATGTATTGTTTAAT
TTGCTTTAACAGGACACGCAAGAGTTCCCTGGGTTAGATGGAAACTTCTTCAGCACGTCA
TCTTCTCCTTCAATCAATGCATTCTCATATAGTGCTGCTGTTATGGGGAAGATACCAAGG
CCCATCGCTCCGGTATGTCATGTATTATATCATGGTTAAAATGCATTAAGATATAGCAGT
GTTACAGCAGTTAAACACATATGTTGCAATCATTTGGAAAATGTAAATTAACAGATAAAC
AGCAGCGCCCCTTACCCATCCTCTGCTGCAAACCTCAATGAAAAGTCCCAAGCACAGAAG
ACTAAGAAGAGGAGGAAGAAAGCAGAGCGGGCTGCGAGAGCCGCAGATGAGGAATATGCA
GAGATCAGCAAAGAGCAAGAAAATATACAAGTATTTAAAATTAATTCAAAAATTTGTTTA
CACTTTGTAAATTTTATTTTGTAAGGGACCAAAAATTTAAGCCAGATTTGACCTGTTAAC
CGATAGGTGTTTTTTAAAGTTTTTTTTTATTTGCGTAGATATACGAGTATGTGTAAAATT
AAAGTTTAAAATATTTTTAGACTTCTATTCTATACGGGCGAGGCCGTTTGGACCTATATA
TTAATCCAGATTTGGATCTTTATTACCCCAAAAGTGCTTTTCTAAATTAGCTGTTCTGGT
ATTATTTGTGTACGATAATTTGACGTCCTATACAATGAATATATATAAAATAACATTACA
CTACAATACCTTTTAGACGATACTAACCTATCTATAAACCACAGAAAGTGCTGAAGAAAA
CAGCTTCGTCTCGAAACAAAAATAAAAACCAAGTTCTTGATTTGGGTGAATTCTTGACCT
CAAAGTTTGAGGAGAAAAAACTATTGTCGGACTCTCCAACTAAAAACACTGAAGTTGCGA
AATCTTGGGAAGAAGGACATTTAGTTGCAAAACCTCCACTTGATTTAAATATGAAGTGGG
TTCTCTTGTTGGTATTTCTAGATATTACACTTGTTTTCTTTTAGGCATTACAATTATTTT
TTTAAACAGCTCTTCTGGCATTTATTTGTGTTCCTGTATTTAGAAATACTGTAGGAATGA
CACCCAGTTGAATGCTAGATCCTAGCTGTTTTAGATAACCAGTTAATATCCAAAATTATC
ATAATTAATATATATATTTAATATCTTTAAAATATAACAGCAGCCGTTTAAACATGGAGA
TAGTTTTTAATTATACTTTGACATTTGATTGCATATTTTTGTAACTATTTCATGGATAGA
GCATTTTACAACTTTTCAGGATTTGTTACATTTGAGACACTCCATACACGTTGCCTTTGC
TATATTAACTAAAGCAAAACATTTTTAATTGTTATTTTTTATTTTCTGGATTTACAAAAC
AAATGATTTCAGAAGAAACAGTAATACCCTTTTTGCATGGTCACTTTTATGCGCGTAAGT
ACTCGCATATTTACTCGCAAAAACAAAGTTAACACGCATAATGTCATAAGCATGTTACCT
GCTGTAGGAGGTTGGTTGTTACTCGCATTATGCGAGTAAAGAAAAGTATGGTGGAAGTAC
AGTTTCACTTTTAAGAGCCTAATCTTTTTCGGGTATTATTTTACAGGATTTAGTTGGTAA
TAGCACCATGAGGTGTTAAAACTTATTTTATAAACTAGATTTACCAATATTGCGCTAAAA
TAAGCTTACTGAATGTTGATACGCGCATAAACAAAATGACCATGCAAAATAACGCTGTTA
GCGAGTTATCATATGACGAGTTGATGCGGATCGCTATTCGCATTAACTTTTTACCATGCA
AAAAGGGTATTATTGAACTTTAAGTATACTGTTTATTATTTAAATTATTATTTTGTATCA
GGATCAAACCAACTGGTCCTCCAGCAAATGCATTAGATAGCACAGCACCTTTAATTAAGA
AAGGAAAGGAGAGGGAAGTTCCCAAACCTAAGAAACCAAGTGCCCTTAAAAAGGTTTCTA
CTTTAATATGTAAAATTTGTTTTAGAAAACATATTTTTTAGTTCTTTCTCCACACAGTTG
TCTGGCTGAGTGGTTAGTCACTTGTATTGTAACCGATGGATATGGGTTCAATGCTTGGTG
CTGTTAATACTACCATTGTTGGTGTATGTTTGCTTGGGCAAGACAATTAAAATTTATTGC
TTCAACCAAGTAGTCACTAATGGATTGTCTGTCAGCTATACAGAAACAAACATTCACTCG
CATAGTTAAATGCATGGTGCGTGATAACTCGTAGGCGGATAAGTAGTCTGTGTATGGAAC
AGAACACCTGTGTTATATTGACTGTCGTTACCACACAAGGCAGGGCTAAATAACTTACAT
TTATTTATTCAGTACATGAAATAAAATAAGATATAAATGTAATACATAAGTACAACAACG
GATTCACTTTGAAAGCTTATTTCTTCCCATTCTTACACAGGTGATCTTAAAAGAAAGGGA
GGAAAAGAAGGAACATCATTTGAAACAACTCACAACGATGTTAAGTCCTGAAACTGACGT
GCCACCTTATCCTCCTGCACTTTATAAAATACCAGGTTTGTATTTATACCTGTTGGGCAA
CATGTTTATCTGTTTTTCGTTTCTAATAGTCAATTTTTAATGTATATAAAACCTGTCATT
GATTCTGTTTAAATAAAAGACTGAGGATACCATTTGGGCCAACTGGCTAGGCATATATCT
TTTATATTATACAATTTGTTGGATTTAAATTTTGTCTGTTACCTATTTCGTATCACCGGA
TCCTGACTACCATTGATATCATACCTGAACAATGGTAGTCTGTACCTTATGGTGGACACT
TTTGTACAAAAAACATGTACGAGTTCGTTTTAAACCGTAGTGTAAGTCTGGTGATTTTCT
AAATCTGTTGTTTTTCTAAATCTGTTGTTTTTCTTTCAGTACCAAGTGACGATGAGAAAT
CATTAGGGCACGACACAAACACGGAGGTCAGCGTTAGCATTCCGCCCACAGTACCTCAGA
TACATAGTCGGAGATATAGAGAGTGAGATATTTATGTATTGTGTTTTTATATCATGTGGG
TGAGGTCCCGTAGCGTGGTGCGTCATCGGTCTTAGGATTGTCACATTTCCCCAATATTGT
GTTTGGCACTAAATGTGGTTGGGTCAAAAATCAAAACCTAAAGATACCAGGTTTAATGCT
AGGCTCTGTTACCATTGTGGGCGTGTGTGTTTCTTTGGGCTTAACAGCGATTGTTTCAAC
CGTTGGTCATAAATGTCGTTCCCAAATTATTAGCCATGCAGAATAAAAAGATAATTTACA
AAATACAATTATTTTCACCCACAAAGTTACATACGTGGTAACTCATAAGCGGGCTCGAGG
TATATGAAACAGAACGCCCGTGTTATAACGACTGTTGTTTCCGCACCACACAAGGATAAG
TATTTTCATTCATAACTCATTGTTTAATGATTCATGTCCACCTAGGTATTGCTGTCAAGT
CCTTGACAAGCGAGTTGATGAAATGAGCAACCAGATGTTACAGAGACTCGTCTACTTTCA
AGATAGGTGAATATAATCGTGCACGTAGTTGTAATGCATCTCTTTACATCAACTGTTGTT
GTTTTTGTTTAAGTTGTTAGGTTGATGGATTCTGCATTAACAGTTTAAATTTACAGACTT
TACAAAACTGACCCAGCGAAGGCAAAAAGAAAACGCAGAGTTGTGCTTGGTTTTCGTGAG
GTGACTAAGCATTTAAAGATGAAGAAATTACGCTGTGTCATCATATCGCCCAACCTTGAA
AAAATTGAATCAAAAGGTAAAAAGTTATTAAAAATTTGCGTTAAAAAAGTGTTCGGATTT
TTTTTCATTGACAATTTTTTTAAGCTTAATTATTTTTTCTTGTAAATCTTCTAATTATAT
AAATGAATGTCATAATTAAATAAAAAACTTCGTTCTACCTGCTCCTGTTAAATACGTTTT
TGGTGTGTTGTTTTATACCCTGATGATGTATAACTTTATGATATATAACGAAATAATGGT
TTAATAAAAATATGTGTTACTTTAGGTGGTTTGGATGATGTCTTGCATGAAATACTTGAT
CTCTGTAAAGAACAAAATATTCCTTATGTTTTTGCTCTTGGGAAGAAGGCACTCGGACGA
GCTGTTTCGAAAACTGTTCCCGTGTCGATTGTTGGTGTGTTTGATTACAGCGGTGCAGAG
GTAACTTTTGGATAAGTTGTTGGTTAATATATTTGATCTATGACACAGACAGACAAAAAA
TGAGGAAGGATTTTATTATGTAATTAATAAAAATTATAGCTGTTTTTTTTACCTGGTCCC
ATGACTTAGTGGTTCAGGGGCATGCATTGTAAATAAAGGATACTGTGTTTAATACTGCCA
ACATTATGTTTGTGGTATGTGAAGTTAAGTTAAACATTCAGTCTGGCACTGTTACTCAAT
GCTTAGTCATTGTAACTAAAGCATGATAGGTTAAATTTTTGGGTTGTCTTTATTATATTG
TCAGCCATATATTAAAATAATAATTAAAATCCAAAAACTATTCACCCTCAAAGATACATA
CTTGGTAACTCGTAAGCTGGCACAAGGTTTATGTATGTATGTAACACCCATATTATAACA
ACTGTCACTGCCCCTGCCATGCAAGGATAAACGAATTACAATCAAGTTACAGTAGATTAA
AGTTATTGCCTAATTATACAACAATATCATCTTATGTAGGCTCAGTTCAAGCAGCTTGTG
GAACTTGTAAAAGAAGCTCAACTTCAATATAAAGACATGGTTCAAATATACCAGAAGCAA
GTTGCTGAAGCCAACAAACCTGTACAGGTGCGGAAAGTTTGTAAACAGTCTTTGTGGAAA
AACTTTTGTATCTGTTTTTTTTCCATTTTTTTATACATTTTATTTTCTGTTAAGCTAGTT
AGTTTTTTGAAGCTAAATTCTTTTTTTTGTTAGTTTTTATAAGATTATAACAGCCCATAC
ATATGACACAATTGTATTAACATTCAAAACTAAAACCACCTATAGCGATATGAGAAAGTT
AAATAATCTAAATTGTTTTAATTGTCCCACCACTAAGCAAGAGAATGGATTCTTTATTAT
GGTTTTAGTTTTTAAACTAAAACTTGAGAAATTGTGCCATGTATATTGTGTATATCGTGT
TATGTTTGTATTTAACCTAACCAGATTTATTTATACATTTTAAGTTTTACGGCGTCTTAT
AGTCATATTAATACTGCCCAGATTTTTTAATACATTTCAAGTTTCTTTCTATTAAATTCA
CATTGAAACTAACCAGATTTATATTTTTCATTTTACGTTCTGTTATATGCATATTGAAAC
TGATCAGATTTATGAATACATTTCAAATTTTCCATATATATTTTTGTACAGAGTGCTGGA
CCCTCGAAGAGATATGCGTACATGACCCATTCACGCAATGCATCTGCCACCAGCCATCTG
TCGGTTACCAGCATTATATCTGAGCCTATATCAGAGATGAATGAAGGTGAATTAATTTCG
AAATATACTGTTTCAAAAGTTCTATATTTTATTTAATCACTAATAAAGATACAGAATATT
TTTCTTTTTTTTTAATTTTAAAATTTTGGAAAGCTTAAAGGTCTTGCCTAAAATACAGTT
TCTATTTGTTAGAACTCTGCAACTTATAAAATATTTTCTACCTGTACTGTTTTGCTGATG
TTAATTATCTTCCAGGGAGTAACTGGAGGGTGATCATGGATGCGGGAGAAGATGGTCTCT
CCCCTCCTCCCGAGGATGATGTATCAGAAGAAGAAGAAGTGGAGGAAAGTCCAGGGAAAG
AGAAACCAGCTCCTCCTGTTCCTGTGAAGGGTGGGGAAGAACTGAGCCGCAAGGATTCCG
GGAGCACAGTTGTTGAGTGCCCGCATCCGGAGTTACAACCAGATGATAACTTTGTGTCCG
AGCTTCCAGGAGAGGAGGAATCATCATCAGTGGATGCAGAGGATGCTGAAGAGATGAACT
TGAACCATCGACGAGCGCTCGATAAATCTTTCTCCACGTGCAGCACCCTGAAGCCCGAGG
GTGGAGTGTCTCCCCGCATCTCAACAACATCCGAATCTTCATCGTTGATCCCAGATGATG
TTAGCTCCCAATCATCTGCCCAGGATCGGATCCAGCTTTGGTTGGAGGACGCGACTCGAT
CCGTTGTAGATCTCGATCTCAATGATGTTGTTCCGGATGCGGAGGATGTAAACTCTGAGA
GCAAACTCGTTACTCCGGATGTAAATGAAAGTAAGTGAAGCCCAATTATTTACCCCCTAA
TATAATATATGCCACGTATGATATTTTGCCCCACCACGCAAATAGGGGTTTAATTAGTAA
GGTACATATTGCTTTTTCTTCATTATAATCTGCAGTTGCAGTGTTATATTACTACGATTC
GCTTTTAGTTGCCCTCTTACTTTTGAAGCTAACAGCCGAGTTTTACCATTTCTTTGCCAA
TCGACCTTTGCATTTGTTTCCTAATTAAACTCAACCCCAATGAAGTCCCGCAGGTATTCT
CTGTTTTGGAAAGATGGGTCATTGAATCCGGTGTTATATTTTTGTACTTTTTCGCAATTT
TGCGCAAAATCGGCTTCATTTTTCTTTGTTGTAAAATACTTGTACACCCTGAGGTGTTAT
ACATATATTCGACAGTATGCAATGTGTACGATACGTTTTTAAAGTTCCTTGTTCGATTTT
TGCTCTGTATATGTATGCGGATATAAATCGGCAAGTATTGTGCTGTCGTCACAGCCGTAA
CTTAATATATAGTAGGGTGGGGGAAGATGGGACACCTTTTTAATCTATTTTTTCCTCCAA
TTTGGTAGTAAACGAACGTTCAACGATTTTGTATGAAACTTAATCCTCGCGGCTCCCATA
GATCGTTGTTAATTGTTTAAAACACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
TCCCCCACCCTACTATACAAATAAATATCTCTTTTGGTAAAATAAAGTTAATTTTTCATC
CGCTAACAGCGAGGCATCATCAGGTTATAAATGTAAATGTTTTTCCATAAGAGTTATTTA
TTTATAACTTAGCAATGCTGTGACATATCAGTAATTCCTATTTAATGGATCGAGACATTT
ATTCAACTTTTATTAATGTTTAAACTTGGCCTACCATGCCTACCATATATACTACTCTTG
TTTTTTTGCCCCACCTGGCTAACTGCTGGTTGGTTTATTTTGGCTTTGTATTTAACTTTA
CCAGATATTAATACAAAATAATATCCTTAGACCTATATACAACCGTTTGTTGCATTAACT
GTTGGTAAATTCCAATACGAAATATCAAATATGTTAGAATGCAATTTTATTAGTTTTCTT
TAACGAGTTATATTTCACACTCTACGACAGATCACTTACAAATTGTTAGTATTTTAGGTT
AGTGGGTATATTTTTTTGGGGGGTGATCGTCAGAATCTAGTCGTATCCACTAGTTCCCAT
TCATTATATTTCTGCAATTACGTTTCATGCAACGAACGCATCCACTTAGTTGCATGTGCT
CAGGTATGGTCATCCCGGCTGGGCACTCAGATGCACAACTGCTTCGCTTGCATGCGGTAA
CCGGTGCAGCGCAACGGGCGACGCACGCTTTACAGCTTGGGAATCTCGGCAAACATTGAG
TCAACCCGCACCTGATCATGCAGCGATTAGCGCCACTGCCTTCGGCCGCTAAATATAAAA
GGAATATTGGAATATTGCAAAAAAAATATTTCAAAAGATATTACCTTCGCGAGTTGCGTG
GCAGACAGAAGGACATGTAGCTAAAGCGCAAGGTTTCATTTCCGTGCAATCATCTTTGCA
CGTTTTCAGGCACCTTGGCACCCCAGTTCCCATCAATCCTCCATGATGGCGGTTTCCACG
GGCATCAACACACACCGATGCAAGCACAAGTACAATTGTAACAACACAGAACGTTTTCAT
TTTGATCGGTTGATAGCTTCTGCATGTAGATAATTAAAATAATTATTATTTTAAATACAT
TCGCTCCCCTGTTTAACAATTAGCATTAGCTACAAACAACAGCAACTACTTACAGTCCTG
TTGACTCCAAATGAAGCTTTTCCTTGCAAAACGCAAGCTAAGTAAATCGCTCTGCACGGT
TGGATTAACCTTGTGCTCCAATTCCGCTAGCTGTTTCTGCTGATGATGGAATTTGTCAAA
AGATCACGCGTTCAAAGCGTCGAGCTTCAGTGAAGCGAAAATGGTTCGTTTTTTGTCTTT
TGGTAAAACATCAGTCAACGGGGTACAATGCACTTGTTTTTGACGTTTTCGTTCATAAAT
TGGCCTCAATTGAACTTTTCTGTTTGTCGCCTTATTCAACACGGTATATGGGAGAGTTCG
CTTTGTTTCACATGCTAACTGTAATATATTTCATTAATCTGTCCTTGGTCTCCTTTATAA
GTTGCACGATTCTCGTAACGAAATAACATTCAGGATCAAATGCTACGAAATGTCCAACCG
ACAAAATTCCAAACGTTTTTTATATTGTTGAATATATTTTTCATTCAAAATTGCATCTCT
GTTATTTAAAAAGAATCATATTTTGCCGTGAAGGAAGATGCTGTTTTAGGCGAGTATATT
TCCACAAAAAAAAAAACGTTGGTCTTGCTGCCTCGTTTGACCCGCGTTTGCTAGAATGTT
CGAACCACCTCCTGCGTTTTTTCTCTCTTCACGTCGGTGGTGGAATAAAAGAAAGAAACG
TTGAAGAGAATTAAAGGAGGAAAATATTGTTGTTTTGAGCTGGTGGGGGTTATTGAGTCG
AAAACATACCCACAGAATCTTAGTCTGCGGTGCTCGAGCTCGAACCGCTCAGACGCCGCT
GGGTTTTGTTTTGCAAAATGCAGGCGCTTGTTTTGACATTGGTTAAATTGCATTGTTACT
GGCAAACAAGTTCCACAAGCGTACATTAAACGTTAACGCACATCTACGAAAGAATCCCAA
AACCTGCTGCGGAAAATATATTGAAGAAAGTTAATAGCAGTAGTCTTAAACTGGCGAAGA
CGATAGTGTATATAATATACTCTCACTAAGTAACATACATGGTTACTCATAAGCTGACAT
TGAGTGTAGCCTATACGTCCGTGTTACAA
Chart Advanced