SelenoDB
Release 2.0
Chart Advanced
Sequence Report for SEQ00000139_2.0
Identity
SequenceGlutathione peroxidase 7 (GPx7)
SpeciesBos taurus (Cow)
DescriptionGenome -assembly-
Sequence IDSEQ00000139
Sequence release2.0
External IDNone
Gene SPG00000139_2.0
Annotation
Prediction method(s) None
OrientationReverse
Toolbox Forward Reverse  
Sequence
>SEQ00000139_2.0 # Sequence # Glutathione peroxidase 7 (GPx7) # Cow 
GAAAGTGCTTTTTCACGCACTAGTTTGTCTGAATATTCCAGGGGAGACAGCACACACACA
GAAGTGTCTAACACTGCGTCCAGCACTTATTAGGTAAAATCTTGGTTTTCTTTTATTGGC
TAGATGAAACAATGGAGGTTCAGGGAGATTAAGTGACTGTGCCAGTGTTACACAGCTAGT
AAGGGGATATTGTTATTTGTTATATTGATTAGCCAGTTAACTGTATATTCAATTTTTGGA
CTTTAATCCTGAGTCTGCTTTCATTGGGAGTTACAAGGCAGATCAGAAGGCTATATAGTT
CAACTTCCTATTGTGTGGTATTCAATCCTGGATTAGCATTGCCAGATAAAATGCAAGATG
GCTAGTTAAATTTGAATATCATATGAAAAATTAGTAATTTTAAAAATATGTCTCATGCAA
CTGTTCCTAATACCAGGGATGACAGTAGCCCTGGGACCCCCTCTGGAGAATGAAGAGCAG
GGTGCAATTGGTCATGTGCTCAGAGGGGAGCACTCATATTCTAAGATATTAGGGGAAAGG
CCTTCTGACCAGGCTTTCCCATCTACCTGAGACTGGTCACCTCTCTCATGGGAGGATTTG
AGATTTTAGGGGGAACCCAGCTGAGGCAGGGGTTGAGACAGTCTCTAGGACATTCAAAAA
TAGACATAGATGATGACAATGAAGTCTAATCAGTCAATATATGCCTTTTGAATACCTACT
ATGGGCCCAGCTGCAGAGGTAGGGGTGTCTCAGATGGTAAAGAATCTGCCTGTAATGCAG
GAGACCTGGATTTGATCCCTGGGTTGGGAAGATCCCCTGTGGAAGGAAATGACCACCCCA
CCCATTGCAGTATTATACATGGTCACAGTTTCTTGTACTTCTTCCTGGTGCTTATCATAA
TTGCAATTGTATAATAACTGGTGTAATTATTTATTTAATGTTTGGATTTTCTTTTATCCT
CTTAGCACCATGACAGCTGGGACACGGGTGTTTTGTTCACTGATGCACCCCTAAAACCTA
ATGCAGAACTTGACACATAGGCAATGCCCAAGAAGTATTTGTTGATGAACAAATGTCTCT
TCCAACCATAATTTTATAGAAAATCCCCTGACACATGCTTTCCTCCCTCCACACTCTAGC
CCAGCTCAGAGAGATTAAAAAGCAGTCAGGATGGGTCCACTCTTTCTCTGAAACCTGGAC
CAGTTGATAGTGAATGAGAATCATCTGAGGGTGAAAAGACAGAGGCCCTTACTGTATCCA
CAGCCAGAAATGAATCCTTCTCCAACTAAACTGTGAAGTGCTAAGATACAACCTAATAAA
TACAGTATTTGGCTTACAAGTAAAGTGTTAGAAGATAATGAAGGCATGAGTAGAAAATCA
AATATTAACTATGTAAGTGTTAGCTGATAACCAAGGAATTAATTTAAAACTAAGTTGTTA
ACAGATATTGCTTAACCAATGACTGAGGTAAGAGTTGTTAACTTAAAGTGAGATTTTTCC
TAGGGGAACCCTTGCCCATTGGAGGGGGCTTGGGAACAGCAGAAAGCTGACAAAACCTAG
GAATGAAGGTCTAGTCAGATCAGATCAGATCAGATCAGTCGCTCAGTCGTGTCCGACTCT
TTGCGACCCCATGAATCGCAGCACGCCAGGCCTCCCTGTCCATCACCAACTCCCGGAGTT
CACTGAGACTCACGTCCATCGAGTCAGTGATGCCATCCAGCCATCTCATCCTCTGTCATC
CCCTTCTCCTCTTGCCCCCAATCCCTCTCAGCATCAGAGTCTTTTCCAATGAGTCAACTC
TTCGCATGAGGTGGCCAAAGTACTGGAGTTTCAGCTTTAGTATCATTCCTTCCAAAGAAA
TCCCAGGGCTGATCTCCTTCAGAATGGACTGGTTGGATCTCCTTGCAGTCCAAGGGACTC
TCAAGAGTCTTCTCCAACACCACAGTTCAAAAGCATCAATTCTGCGGCACTCAGCCTTCT
TCACAGTCCAACTCTCACACCCATACATGACCACAGGAAAAACCATAGCCTTGACTAGAT
GAACCTTTGTTGGCAAAGTAATGTCTCTGCTTTTGAATATGCTATCTAGGTTGGTCATAA
CTTTCCTTCCAAGGAGTAAGCGTCTTTTAATTTCATGGCTGCAATCACCATCTGCAGTGA
TTTTGGAGCCCAGAAAAATAAAGTTTGACACTGTTTCCACTGTTTCCCCATCTATTTCCC
ATGAAGTGATGGGACCAGATGCCATGATCTTCGTTTTCTGAATGTTGAGCTTTAAGCCAA
CTTTTTCACTCTCCACTTTCACTTTCATCAAGAGACTTTTTAGTTCCTCTTCACTTTCTG
CCATAAGGGTGGTGTCATCTGCATATCTGAGGTTATTGAGAAGGTCTAGTAGGGACTGCA
AAATCCCCAGCTGGACTCTAAACTTCTGTGGGAAACTGTTGGCTCATCTGTGGTTTTCCA
GATAGGGTCTAGGCAGAGATGGAATGGAGCCAGTGCTCAAAATGCTTCCCATACAATTAA
GTTTAACCTGCTAAGGGCCAAGCACTGTGCTGAGGAGAGAAGGGAAGGCAGTTACATAAA
GAATGAGACTGTGAGTGATGTGTGAAAGGAAGGGCTTAAGGGGTTTGTGAAGGCTGTGAA
GGGAGAGAGGTGTGTCAGGGAGAGGTGATGAGCTTAGTTCTGGAGACACTGAATTGAGGT
GTCTCTGGTCATGCCCCAACAGGCAAGTGGATATGAGTCCAGCGTAGATACAAAGAAGAG
ATTTAGGTATCATCAGGGTGTGGATGGTGGTCAAGATCTTGAGAAAAAATGAGATGGCTG
TGGCAGAGCATATGAAGTGAGAAAGGGACCAGCCTAGAAGCCCAAGGAAGACCAACAGGA
AGGAGTGGGCAGCGGAGGAAGAGTTACCAACAAATACCCAGAAGGAAGGTGCACCGGGAG
AGATGGGGGAAACCAAGAGAAGGCAGGGGCAGGAAAGCTGAGGGAAGAGAATGTGTCAGG
GAGAGGAGCAGTGAGGTCAGCAACGTCAGATGTGGCTGACAGGTCAAGCAGGGTGAGGTC
AGAGATGTCCATTGAGAATGTGGTTCTGAGATGTTCATCACAAACATTTCTGTGACAGCT
GGGTTTCCCTGTGTGTGTGTGTGTGTATGTGTGCCCGTGTCTCTACAGAAATGATCACGT
GGCAAGCCAGAGCATGGGGAACAATGTGCAAGGACAGGCTGGAGGCCCCCACAGGGTGGT
TTGTGGTCAGCCCACAGAAAGCCTTCATTTACTCTAGGAGCTTTGGGGAAGGAATATTAA
AGTAGGCTTTGAGGATTGTGAGCACAGATCAACCCTTTCTCTGTCCAATGGGAAAATGGA
AGACAGCAGAAGGAACCATTTGCTCAGTCTGTGAGTCAAGGGTACAACCAGAACTTGAAT
CTGAGTCTCCTGCTTCTAGAAGAGTGACTTTGGAAGAAGTGGATATAAAATCCTCATTGG
TCAATAAATTATAGATCAGTGACTTTGCTCATCACCTCAGTTTTTAGATACCTCTTTTTT
AGATTTATATAAAAGTGAAATACATATTTTACATACAAAATGTAAACATTAAAAAAATAC
CTAACAAAGAAAGCGAATGACTCCTGTTATCCCACCCCATGCCCTCACAGGCAACAACAA
TTAACAGTTTTGTCTACATCCCTCCCTCCCTCTCTCTCACGCTTAACATTGACATTTTTA
ATACAAATATTATTCTTGTTTATGCTGGATGTTTTGTGTGCATGCACGTGTTCATTATAA
CTTGCCTTTTTTCACTTTTGGACAACTTTCAGCACAGAAATTAATTTATCTGAACAACTG
TACTAGTGGATCATTTGGTTTTGTGTCATAATTTGCTATAAAACCATACTGATGGACACA
AGGTTGCATAAAGTTTTCACTATAATGAACAATGTGCATATATATTATTTTACATACATA
TTTGCACTGTTTGGGAGTCTTTTCAAAGGAGAAATGATGGAGCAAAGCGTGTAGACATTT
TGTTTTAAAAGATACTGACAAGTCATCCTCTAAAACCCTGTACCAGTTTGTCCCGTCAAC
AGCTTATGTGAATGCCGATTTTCCCACATCCTTACCAACAGCAGGTATTATCATTTAACA
AAATCTTTCCAACTTGAATGAAGCTGAACATCTTTTCATATCTTCATTATCCATCTCTAT
ATTTCAGTGAATTACCTATTCATATTCTTTGCCTGTAATTGAAGTGTATTTTTGGTCAGT
GAATTTCTTATCAGGCAATAATGATTGGTTTGATTAAAATAAGTTTGAGAAGACTTTGTA
CCAAATTGCTAAAAGTTTACCTCCAGGGACCAAGAGTACAGAAAATGAGGGAGATACTTT
CATTTTTTATTTTGTATCATCTTGTATTATTTTACAATGAATTGTATTACTTTTGTAATT
AAAAAAAAAAAAAAAACACATGAAAACAGTAACAGCTACAAATGTTTGGCCTGGATTCTC
ATGGCTCTAAATTCATGTTGAGTTCAAGTTTTTATTGATCACAACTTATTTTTTGGTACA
TATGCAAAAACCATTTATTGAATGCCTCCTGGTTAGCTGGCACTGCCCTTGGCACTTTCA
TAGGCTTTTCTTCCTCATCCTCACAACAGCCCTGTGAGGTAGGAATTGGCCCTGCTTTAT
AGGTAGGAGATTATTGCTTGAAATGCTTCTATTTGCCACACATTCTCACGGGCTAGAGGT
TCTTATCGGCTGGTGAGTCATTGGTCAAGAACTCTCACTGGTCAGGAGTTCCTAGAGGTT
GCTCTAAGATTCAAATAATCAAGCTATTAGAATTTTCCCCCAGTAGGAGTGATGGGGTGG
GGGGACAAGAGTGGAGGAGAGTCAGTGGTCTCTCCCTTTGTAGCACCATTTCAGTCTGCT
TTGGTCACTCATGCACGGTCAGGGGAGGGGATGGGGGTGAGGAGGGAAAGTGGTTATAAG
TCTTCTCGCTTCTTCAGGATGAGTTTCCTCACAAGCGCTGTAATCTGGGGCCTGATTTCC
TCCACCGACACAGTTGGGTCCCAAGCTCCTATCACCTTTCCATCTGGGGCCACCAGGTAC
TTCCAGAAGTTCCAGGTAGGCTCCTTCCCAGAAGTCTCTAGAGAAAAGGAAGGAGAGCAA
AGTGTGCTTCTCTGTGTCCCGTCTCCTGGAACTCCATTAGCGGTATCTATCTCTCCCTTG
AAGCACTGGTTCTATTAGTTAGAATGAACTGCAGAACTTTTAAAGGTCCTGATGTCCAGT
CCATACCCACAGACTACTTAAGGAAGAATCCCTGGGGGTAAGACTCAGGCATCAATATTC
TCTAAAAGTTTTCCAGGAGATTCCAATGTGGTGCCTAGGTCGAGAACCATTGCTTTAGAA
TTCTGTCAAGTGCCTGATAAGGCAATATCTGATCTTCCTTTATTAATGATCTCAGAGACT
TCCCTGGCAGTCTAGTGGTTAAGATTCTGCTTTCACTACCGGGGGCACGGGTTCAATCCC
TGGTTGGGGAACTAGGATTCCGCATGCTGCATGGTGTGGCCACAAAAAACCAAAAAGTTT
TAATGACCTCAAACTACTGCATAGTCTGTAACCTACTCTCTGATTTAATCCTTTTTTTAG
GAGTATTTTATTTAATTTATTATAACACTGTTTCATGTTTTGGTTTTTTGGCCACGAGGC
ATGTGGACTTTTAGCTTCTCCCACCAGGGATCGAACTAGCACTCCCTGCACTGTAAAGGG
AAGTCTTAACCACTGAACCACCAGGGAAGTCCCTGATTTAATCTTAATGGTTCCCATATG
TTAGTCCTTGGACTGGTTGCATCTGAATCATGGTGGTGGTGGTGGAGCGGGGGCTTATAA
TTAAACAGATTCTTGGGTCCTGCTTCAGTAGGTCTCAGGCTAATGTATTTTAAAGAGCTC
CCCAGGTGCTTCTAAAACATGGCCAGGTTTGATCTATAACTATGGGAACTGGGAAGGAAC
TAATAAAAACACACGGGGCGGGGGTGGGGGGGTGGGAAATATTAGGACTCACCCACAGAG
CAAAATTCAAATTGCCTCAAGAAGGGACCTTTGGTTTGCAACACTGCTGTTTGTCATTTA
CTCTTCCAGGTAAATGGGTTCTGGGGGAGGGCAGTGAGGGATATGAAAGCAACCAGAAGC
ATGGAGTGGGCGGTGGGAGAAGGCAAGAATGGAGCCCCCAAAGGAAGGGAAAAGCCTGAG
AAAGGAAACAGGACTTAATGACAAGATTGGCTAATGACCCCATTTTGTGGTTCTCAGGAT
TCTGGGAAGGGATCTGTTTCTCAAATACCAAGATCTTTTCTTTTTTTTGTTATTTTGGGG
CTTTTTTTTTTTTTTTGCCATGCCTGACAGCTTGAGAGAGCTCAGCTCCCTGACAAGGCA
TTGAATCCAAGCCCTGGAAGGCAGTAGAAGTGCTGAGTCCTAACCACTGGACTGCCAGGG
AATTCCCAAGAGCTGGTATTTTAGCTTAGAAGGTTTACCTCCTGTGGTCTACAGACTGAC
TGCCTCTAACTCAGGACAGGAGATACCTGTCAGCCTTCTCCAGGAATGTGGTGTCCCCTG
TTTGAAGCTAAAATCTGAGAGTGCAGTTTCCTTCTAGGAGCCCCTGTGGATGGTAACAGG
AGTGGAGACAGGCCTGCAGAGTGACTCTGGGGGAAACTGCAAGGCATTAAGGGTGGAGAT
ACTCTTAGGCAGGAATATTCTTCAGTTCATCCTCAAAGATTTGTGCTAGAATAGACCATC
AACCCAGCTGCGGGCATCTAGAAGGGGCCCCAGGTCACCCAGCCAGCCAGTGGCTTCTGC
TGCCCAGCCAGCTGGGGGACTCACCAGTCAGGTACTTGAAGGCAGGGTGGGCACCAGTGC
CGGTGACTGCAATCTTGCTAAACATGGGGAAAGAGACACTGTATGTGCGGCGGGCAAAGC
TCTCGATCTCCTTGTTGCTGTCGGGCTCCTGCTGGCCAAACTGGTTGCAGGGGAAGGCAA
GCACATTGAAGTGGTGGGGCCCCAGGTCCCGCTGCAGCTGCTGCAGGGCCCGATAGTGCT
GGTCTGTGAAGCCACACTCGCTAGCCACGTTCACCACCAGGGACACCTGGGCAGCAAAGA
CAAAACCCAAACATATACACAACCCAGAGAAGAGGCACACGCTCTGACATGCCCACATGT
GTGGCCCCTCAACAACGAAAGCATTCTCTCATATATGCAGGAACACAACGTATACACATG
TAAATGATGCTCTCACATATACACAAACACATACACACAGGCACAAATGAAATCAGACAT
GCAGGGGCTTACAGAAACATAAACACTCAGAATAAGCACACAATAGACATCAGTGGGTCT
GCCTATGGCCTAGGACACAAAGATACTTTAGCACTCACTACTCATGCCCACAAACACAGA
AAGAACACCATCACAGAGAGAGGCACACATACTGGCGAACTCCCATCAGGAGGTGATATA
GGAGACAAAGAAGGCAGACCTGGCTTTAATTTCTGGCTCAGTCAACTAGCAGTCATCATT
CTATACTGGAGTCATCATTCTATTCTATATACCTGTTGGTCTCCCTTCTAGAATGTGAAC
CTGCTGAGGGCAGGAGCTACGTTCACTTCACTGGGGCTGAAACATGGAAAAGTCTTAGAA
TGTATGTGCTAAGTGAATGAGTAAAGGTGCACATATAAATGATCGCCTATGCAATGGGTA
CATAGACAGACATGGTTTTCCTGATAAAAGGATCTCAAGAACCTCAGGGCAATCCTTTTT
TGCCCTTCTCCTTCCAGCAAAAAAATCACCACTTCCTTCTGTCACTAGACTAACCTTTAA
ATAATAATTGCCTTATAACGCATTTATTCATTGCCTTCAGGTGATAAATATAAAGCTGGC
TGATGGAACTCAATTATATGACTGCAATTACAATTTTGGCACCAATGTGCTATATTTTTC
AGCTTCTGGTTACATATTATTGCAGGATTTAAAATCTTACCCTGTATCTGGGCAGCCAAG
TCCTATCAATCTGGCCACCTTTTAATACAAGTGGAAGGATTATACCAGTTGGCTCCATAG
AGAGCCAGGGGCAGCTCAGGGCACTAGACATGCTCAGGCTGGGCAGGGTTTCTAAACCTC
AGCACTACTGACATTTGGGGCTGGGTAATCTGTGTTGTGAGGTAGCTGCCCTGTTCACTG
TAGAATGTTTAGCCATATCCTTGGCCTCTACCCACTAGCCGCCTAGTCTTACTAATCAAA
AAGTCTCCCCCAGACATTCCTGAAAGTCCCCTGGGGAGAAAGATCACCACCAGCTGAGAA
CCACGGGGCTGGATGCTGAGAACCATTGAGCTGTAACTCCCTCACCCATTTCTTGGGGCC
CCAGCCTGTGGCCATTTTGTCATCGTATGCCATATTGTGAGACCCCTTTAGCTCCCTTCA
CTAGGTGGAGGTCTTCCTCTTTCTTCTCTGCTGGATCCCTGGGCGCTGAGAGCATTAAAG
CTTGTATAACCTACATCTTGTGTGTCTGCCCATACTTTTAGAAAGAGGGAAATCCTACTC
TATTTCCATGCCTGAATCCAAAAAGCTTATCTTTAAAGTGACCAAAACACAGACATGCCT
ATGTGCTCAGTCATGTCCAATTCTTTGTGACCCCACAGACTATAGCCCACCAGGCTCCTC
TGTCCATGGGACTTTCCCAGGCAAGAATACTGGAGTGAGTTGCCATTTCCTCTTCCAGGG
GATCTTTCCAACTCAGGGATTGAACCTGTCTCCAGCACTGGCAGGCAGGTTTTTGACTAC
TGAACCACCTGGGAATTTCGAAAACACAGATACACCCAAATACACACAGTTAATTTATAT
ATATACATATATAAGTACAGATGCAAACTCATAGGTGTATGCAAAATAAATAAACCATTC
ACACTGCGGGGGTTTCCCTAGTGGCTCAGATGGTAAAGAATCCGCCTACAAAGCGGGAGA
CCTGGGTGTGATCCCTGGATTGGGAAGATCCCCAGGAGGAGGGCATGGCAACCCACTCCA
GTATATTCTTGCCTGGAAAACCCCCTTGGACAGAAGAGCCTGGCAGGCTACAGTCCATGG
GGCTGCAAAGAGTCAGACATGACTGAGCGACTAAGCAGCACACATACACTACACTCAGGC
CTACACGTACATAACCTCACAGCACAGGCCAGGGAATTCCTGAGTGTCATGCACTCATCT
ACACTCCACACTGGTCTAAAGGACTGTCTCCCAGTTTGTGCCTGAGGACACAAGCCATTC
AACTTTGCCCATGGCTATGTCTCCAGGGCACGTATGGCTATGTCTCCCTGCGGCAGGCAG
TAAGGAAGCCGGTGTTTTGTTTTGTTTTGTTTTTTTCCTAATTAAAAAACAACAAAAAAA
AAACCTGTAGTAAAATATACATAATGAGCCAGTAGCTGTTTGCAGGTGAAGGACTGACCA
TACTGCCAAAGGATCAGAGCAAACTTGGGTTAATTCATAGTATCATTTACAGCTTCCTGG
CCTGACTGTTCCTGGTTTCCCTCTAAAGCTGGAGATTAAGACATGGGCTCTGGAACTGGA
TTGCCTGGCCTCAAATTCTAACTACCTCTTAGCAGCTGGGTGACTTTCTGGATTTTTTGT
TTTTGTTTTTAAATTTCTTTCTGATTGAATTCTAGGCCTCTCACTCCAGTGCTTTTTAGG
ATTTACCAATGACCTAGAGGATGAAAACATTCAGAATTCTGGAACCACTTTCTGGGTAAT
TTTTTTCCAGGATTTCTGTTCCTCACATCCTGGATGCCTTATTACTTCTAAAAACAAACA
GTCTGTGTCTCTTTTTGCCTTAGTACCTTTTACTATTAGAAATTACATTGTTCGTATCTC
TGTTCTTTTCTTGTCTGTCTCCTCTCGACCTCATATAAGCTCTATTTAAATTGAAACTTG
GCCACTTTGTTCACCGTTGCATCCCCTGTACCCTCAGGGCTGGCATGGTACTTAGTATAT
AGTAGGTGGTCAATAATAAATGAGTTAATGAGTAGCAGAGCTGGTCAAGTGTTAAACCTG
GGGCTCTCTCTGATGAGCTGCACTAGAGGGAAGGGAAGGCCCGAGTGGGAATGGGTCCTG
CTCTGACTGGCTGTTTCCCTGAGTCCTGGATGAGATTTCTGCTGGGGCCCAAGAAACACA
AGTACATGGCACTCTACCAAGGGTTTCCACACTGCACGTCATTTGAACCTCACAGTACCT
TGGGGAGGGGGGGAACCTGGACAAGGGCTACTGTCCCCAGGACTCCCAGTATAATTGAGA
ATTTCAAGGGGTAGAGAGTACTTTTTTCATTGAAGATGGCCTTGCTCTTGGAAGATTGCT
AACAGCCATTTTCTTGTGTGGTTCATCCAAACCTGGAGGCTGGGCTACCTGTCCATTAGA
GACCAACTCCTTATCCTTTCCACACACAGCCCCAAGTCTACCTTGAGAAATGAACTTGGA
GGGCTCTTTGTTTCACACAGTGAAACATTTAGGTCTCTGAATAAAGTGTTTAAGGCTCCT
TTTGATCACTCCCTACCCTCTTCAGCCTCATCTTTCAGCAGATGCTTTATATTCCTTCAA
GCACAACGGCTTGAGGACTTCACTACCCCTCATCACCCTTCTTGCTGTTTATTTCTGAGC
CTTGCTTCCCTGGTGGCTTAGATGGTAAAGAATCCGCCTGCAATGCAAGAGACCTGGGTT
CAATCCCTGGGTTGGGACGATCCCCTGGAATAGGGAATGACTACCCACTCCAGTATTCTG
GCCTAGAGAATTCCATGGGCAAAGAAACCTGGCAGGCTACAGTCCATGGGGTGGCAAAGA
GACCGACTGAGTGACTTCCACTTGGCACTGACAGTTCTCTTTGCCTGAAATGCTCTTCTT
GGTTTTGCTAAAACTCACTCTTGTTTCAAAGACTCACCCAGGCACATTCCTCTCTCAAGT
CCTCTCCGAGCTGAGATGCCCCCTCTGTAAGGAGGTAGCAATTAGACTGGATGACTCTTC
CATCTCAATCTGAGCTGCCATCTTAAAAGTTTGCCTAGAGGAGACCACGGATGGGTGAGT
GGTTCTCCTCCAGGCTCCCTGCTTTCTAGCGCTGTGTGACCCTCCATCTCTGGGTCTTAG
TGTACTCTCCAAAACTGGGCTCTCCAAGTTTTAGAGAGTACTCTAAACTCTGTACTCTCC
TCTGGGCTCTATTGCCTGATGACCTGAGGTGGAGCTGATGTAATAATAATAGAAATAAAG
TTCACAATAAATGTAATGCATTTGAATCATCCTGAAACCACCCCACCCTCCCCACCCTCT
GAAAAAATTGTCATTAATGAAACCAGTCCCTGGTGCTAAAAAGGTTGGGGACCGCTGCTC
TAAAAGACGATGTGTAAGGTCCCGGTGCATCTGAAGTGATAACTTCCTCCGCACCGAGCT
TTCATTTCCACAGTGTTCTCAATGCACTTAATATAGCCAACTCCCTTTGTTCCGGTCGCG
GAAACTGGGGATGGGAGAGACAAAGGCTGCTACTGTTAATTTTTAAACCTGTGCGTGACA
GGCTGCGCCCCGCTGCCCAAAAGCGCTGGGAGGGAAATCGGCGCGAGCAGCGAGAGTTTC
GGGTTTCACCGCGCACGCCGGGCCGTGCCACGTAGTCATGGGACAGACCCGGCCGAGGAT
CTGGGGGCGCCACGCCCGGGGGGGATGCCGGGGTGGGGGCGGGGAGCCAGGGCTGGGTGA
CCGAACGACCCGAGCCCCACGGAGCCCCATCCGGCAGGGTCCTGGGCGCCCGGCTCCAGG
GCCAGGGTCCAGCGGGGCGGCGCCGAGGCCCGGCGGGCGGACACTCACCGAGCCTCGGTA
CTTCTCCAGCGACACCAACTTGCCCCGGATGTTGACGGCCTTGAAGTCGTAGAAGTCCTG
CTCCCGCGGCGCGCAGGCCGCCGCAGCCAGGAGCAGCCACGCCGCCGCCCGTGCCGCCAC
CATGACTCGCTCCGCAGCAGGCGGCGTGGCGAGGGCAGAGGCAGGGCAGGGGGCACGGGC
GCAGCGGGGGCGGGAGGCAGGAGGGGGCGGCCCCGGCGCCACGCGGCCCTCCAGGCAGGA
CGCGCCCCCTTCTTCCCC
Chart Advanced